Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.

Slides:



Advertisements
Similar presentations
Mutations. A. Introduction to Mutations -A mutation is a change in DNA sequence (order of nucleotides). -Mutations are important because they increase.
Advertisements

DNA and Protein Synthesis DNA contains the genetic information to make amino acids Amino acids combine to make proteins These proteins determine the physical.
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.
Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.
Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
Gene Mutations Chapter 11.
DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.
  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.
Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.
Mutations A change in the DNA of an organism. Conditions caused by Mutations Cancer – the genes that code for cell division have mutated. Normal cells.
Welcome to Genetic Mutations! 7x2WSY 7x2WSY.
Genes in Action Chapter 14. Sex Linked Traits Another way for traits to be passed on is by being sex linked Female Chromosomes: XX Male Chromosomes: Xy.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
Mutations. I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription,
DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.
MUTATIONS Intro video
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
What is a codon? Above it shows how we read triplets, codons, and amino acids in a READING FRAME. For instance if we looked at the codons out of ‘reading.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons.
Mutation Notes: Chapter 11.
Human Genetic Mutations
BLA Biology ( ) June 6th 2017.
Mutations.
11.3 Mutations.
When things go wrong in the DNA!
Every living organism inherits a blueprint for life from its parents.
Mermaid Syndrome Video.
Get ready for a good day!!! (Get Hype!)
Catalyst Create a circle map about mutations. Mutations.
Gene Mutations Chapter 11.
The Central Dogma Through the production of mRNA (transcription), and the synthesis of proteins (translation), the information contained in DNA is expressed.
Biology Mutations SNL Biology Copyright Pearson Prentice Hall.
Mutations Announcement Quiz over Mutations on Monday!
Gene Mutations.
MUTATIONS.
Protein Synthesis.
Mutations.
Activator? What is a mutation? What happens when there is a mutation?
Catalyst Create a circle map about mutations. Mutations.
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations.
Mutations.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
DNA and Mutations.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Human Genetic Mutations
Welcome to Genetic Mutations!
Chapter 11: DNA- The Molecule of Heredity
DNA and Mutations.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
1) Base Mutations 2) Chromosomal Mutations
Mutations Notes.
Mutations: Changes in Genes
Presentation transcript:

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA

V. Mutations

A. Introduction to Mutations -A mutation is a change in DNA sequence (order of nucleotides). -Mutations are important because they increase genetic variation.

Mutations in Body Cells -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems in your body. A cancer cell.

Cancer as a result of mutations in body cells: A person with skin cancer-This is why it’s important to always wear sunscreen!

Cancer as a result of mutations in body cells: Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!

Mutations in Reproductive (Sex) Cells -Mutations in sex cells (sperm and egg cells) can lead to changes in the DNA sequence which will can be passed down to a person’s children.

Mutations in sex cells -X-men and X-women would be a result of mutations in sex cells. These people inherited mutated (changed) DNA from their parents:

One last X-woman…

Genetic Disorder Some kinds of dwarfism can be inherited because of a mutation of a sex cell.

Good vs. Bad Mutations Mutations can be good as well as bad. A good mutation could lead to a change in a protein that allows an animal to run faster or see better. A bad mutation could lead to a change in a protein that causes a genetic disease such as Sickle Cell Anemia or Hemophilia.

Mutagens A mutagen is something that causes a mutation. Ex: radiation, chemicals, high temp.

Chernobyl

B. Gene Mutations There are 2 main types of gene mutations.

1. Point mutation -Point mutation-a change in one base pair in a DNA sequence. -A point mutation can cause an amino acid to change, which will change the structure of the protein being made. Example: AUG=Met AAG=Lys -Only one letter was changed (the A to a U) and the entire amino acid changed (from methionine to lysine).

Picture of A Point Mutation Normal Point mutation mRNA Protein Stop mRNA Protein Replace G with A

Point mutations in our lives! -Sickle cell anemia is a blood disease caused by a point mutation. -A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu

Point mutations in our lives! -People with sickle cell anemia often experience a lot of pain and swelling and have trouble exercising. Sickle cells do not move smoothly through blood vessels like normal cells do. Sickle cells get stuck and cause blood clots. Sickle cells also can’t carry Oxygen as effectively as normal Cells.

-Frameshift mutation-adding or deleting nucleotides to a DNA sequence. -A frameshift mutation is much worse than a point mutation because it causes the entire DNA sequence to be shifted over! Example: DNA: ATTAAACCG ATAAACCG 2. Frameshift mutation Delete this T

V. Frameshift mutation mRNA Protein Frameshift mutation Deletion of U

Frameshift Mutations Crohn’s Disease is caused by a frameshift mutation. It causes inflammation to the digestive tract.

Difference between a point mutation and a frameshift mutation.

Questions: Is this a point mutation or a frameshift mutation? -It’s a point mutation because only one nucleotide changed!

Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Point or frameshift? Point!

Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Point or frameshift? -frameshift