Disk-Covering Methods for phylogeny reconstruction Tandy Warnow The University of Texas at Austin.

Slides:



Advertisements
Similar presentations
CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.
Advertisements

A Separate Analysis Approach to the Reconstruction of Phylogenetic Networks Luay Nakhleh Department of Computer Sciences UT Austin.
Challenges in computational phylogenetics Tandy Warnow Radcliffe Institute for Advanced Study University of Texas at Austin.
Computer Science and Reconstructing Evolutionary Trees Tandy Warnow Department of Computer Science University of Illinois at Urbana-Champaign.
Large-Scale Phylogenetic Analysis Tandy Warnow Associate Professor Department of Computer Sciences Graduate Program in Evolution and Ecology Co-Director.
Computational biology and computational biologists Tandy Warnow, UT-Austin Department of Computer Sciences Institute for Cellular and Molecular Biology.
Molecular Evolution Revised 29/12/06
High-Performance Algorithm Engineering for Computational Phylogenetics [B Moret, D Bader] Kexue Liu CMSC 838 Presentation.
Genome Rearrangement Phylogeny
BNFO 602 Phylogenetics Usman Roshan.
CIS786, Lecture 3 Usman Roshan.
Phylogeny reconstruction BNFO 602 Roshan. Simulation studies.
BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA.
CIS786, Lecture 4 Usman Roshan.
CIS786, Lecture 8 Usman Roshan Some of the slides are based upon material by Dennis Livesay and David.
Computing the Tree of Life The University of Texas at Austin Department of Computer Sciences Tandy Warnow.
Computational and mathematical challenges involved in very large-scale phylogenetics Tandy Warnow The University of Texas at Austin.
Combinatorial and graph-theoretic problems in evolutionary tree reconstruction Tandy Warnow Department of Computer Sciences University of Texas at Austin.
Phylogeny Estimation: Why It Is "Hard", and How to Design Methods with Good Performance Tandy Warnow Department of Computer Sciences University of Texas.
CIPRES: Enabling Tree of Life Projects Tandy Warnow The Program in Evolutionary Dynamics at Harvard University The University of Texas at Austin.
CIPRES: Enabling Tree of Life Projects Tandy Warnow The University of Texas at Austin.
Phylogenetic Tree Reconstruction Tandy Warnow The Program in Evolutionary Dynamics at Harvard University The University of Texas at Austin.
Complexity and The Tree of Life Tandy Warnow The University of Texas at Austin.
Maximum Parsimony Input: Set S of n aligned sequences of length k Output: –A phylogenetic tree T leaf-labeled by sequences in S –additional sequences of.
Computer Science Research for The Tree of Life Tandy Warnow Department of Computer Sciences University of Texas at Austin.
Gene Order Phylogeny Tandy Warnow The Program in Evolutionary Dynamics, Harvard University The University of Texas at Austin.
Rec-I-DCM3: A Fast Algorithmic Technique for Reconstructing Large Evolutionary Trees Usman Roshan Department of Computer Science New Jersey Institute of.
NP-hardness and Phylogeny Reconstruction Tandy Warnow Department of Computer Sciences University of Texas at Austin.
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
Software for Scientists Tandy Warnow Department of Computer Science University of Texas at Austin.
CIPRES: Enabling Tree of Life Projects Tandy Warnow The University of Texas at Austin.
Benjamin Loyle 2004 Cse 397 Solving Phylogenetic Trees Benjamin Loyle March 16, 2004 Cse 397 : Intro to MBIO.
CS 173, Lecture B August 25, 2015 Professor Tandy Warnow.
394C: Algorithms for Computational Biology Tandy Warnow Sept 9, 2013.
394C, Spring 2013 Sept 4, 2013 Tandy Warnow. DNA Sequence Evolution AAGACTT TGGACTTAAGGCCT -3 mil yrs -2 mil yrs -1 mil yrs today AGGGCATTAGCCCTAGCACTT.
More statistical stuff CS 394C Feb 6, Today Review of material from Jan 31 Calculating pattern probabilities Why maximum parsimony and UPGMA are.
Statistical stuff: models, methods, and performance issues CS 394C September 16, 2013.
CIPRES: Enabling Tree of Life Projects Tandy Warnow The University of Texas at Austin.
Introduction to Phylogenetic Estimation Algorithms Tandy Warnow.
Algorithmic research in phylogeny reconstruction Tandy Warnow The University of Texas at Austin.
Algorithms research Tandy Warnow UT-Austin. “Algorithms group” UT-Austin: Warnow, Hunt UCB: Rao, Karp, Papadimitriou, Russell, Myers UCSD: Huelsenbeck.
GRAPPA: Large-scale whole genome phylogenies based upon gene order evolution Tandy Warnow, UT-Austin Department of Computer Sciences Institute for Cellular.
Using Divide-and-Conquer to Construct the Tree of Life Tandy Warnow University of Illinois at Urbana-Champaign.
598AGB Basics Tandy Warnow. DNA Sequence Evolution AAGACTT TGGACTTAAGGCCT -3 mil yrs -2 mil yrs -1 mil yrs today AGGGCATTAGCCCTAGCACTT AAGGCCTTGGACTT.
Problems with large-scale phylogeny Tandy Warnow, UT-Austin Department of Computer Sciences Center for Computational Biology and Bioinformatics.
CS 598 AGB Supertrees Tandy Warnow. Today’s Material Supertree construction: given set of trees on subsets of S (the full set of taxa), construct tree.
CS 395T: Computational phylogenetics January 18, 2006 Tandy Warnow.
Statistical stuff: models, methods, and performance issues CS 394C September 3, 2009.
Iterative-DCM3: A Fast Algorithmic Technique for Reconstructing Large Phylogenetic Trees Usman Roshan and Tandy Warnow U. of Texas at Austin Bernard Moret.
Approaching multiple sequence alignment from a phylogenetic perspective Tandy Warnow Department of Computer Sciences The University of Texas at Austin.
Simultaneous alignment and tree reconstruction Collaborative grant: Texas, Nebraska, Georgia, Kansas Penn State University, Huston-Tillotson, NJIT, and.
Chapter AGB. Today’s material Maximum Parsimony Fixed tree versions (solvable in polynomial time using dynamic programming) Optimal tree search.
The Tree of Life: Algorithmic and Software Challenges Tandy Warnow The University of Texas at Austin.
Absolute Fast Converging Methods CS 598 Algorithmic Computational Genomics.
394C: Algorithms for Computational Biology Tandy Warnow Jan 25, 2012.
Distance-based phylogeny estimation
The Disk-Covering Method for Phylogenetic Tree Reconstruction
New Approaches for Inferring the Tree of Life
Multiple Sequence Alignment Methods
Challenges in constructing very large evolutionary trees
CIPRES: Enabling Tree of Life Projects
BNFO 602 Phylogenetics Usman Roshan.
BNFO 602 Phylogenetics – maximum parsimony
CS 581 Tandy Warnow.
CS 581 Tandy Warnow.
CS 394C: Computational Biology Algorithms
September 1, 2009 Tandy Warnow
Algorithms for Inferring the Tree of Life
Tandy Warnow The University of Texas at Austin
Tandy Warnow The University of Texas at Austin
Presentation transcript:

Disk-Covering Methods for phylogeny reconstruction Tandy Warnow The University of Texas at Austin

Phylogeny Orangutan GorillaChimpanzee Human From the Tree of the Life Website, University of Arizona

Evolution informs about everything in biology Big genome sequencing projects just produce data – so what? Evolutionary history relates all organisms and genes, and helps us understand and predict –interactions between genes (genetic networks) –drug design –predicting functions of genes –influenza vaccine development –origins and spread of disease –origins and migrations of humans

Reconstructing the “Tree” of Life Handling large datasets: millions of species NSF funds many projects towards this goal, under the Assembling the Tree of Life (ATOL) program

Cyber Infrastructure for Phylogenetic Research Purpose: to create a national infrastructure of hardware, algorithms, database technology, etc., necessary to infer the Tree of Life. Group: 40 biologists, computer scientists, and mathematicians from 13 institutions. Funding: $11.6 M (large ITR grant from NSF).

CIPRes Members University of New Mexico Bernard Moret David Bader UCSD/SDSC Fran Berman Alex Borchers Phil Bourne John Huelsenbeck Terri Liebowitz Mark Miller University of Connecticut Paul O Lewis University of Pennsylvania Junhyong Kim Susan Davidson Sampath Kannan Val Tannen Texas A&M Tiffani Williams UT Austin Tandy Warnow David M. Hillis Warren Hunt Robert Jansen Randy Linder Lauren Meyers Daniel Miranker University of Arizona David R. Maddison University of British Columbia Wayne Maddison North Carolina State University Spencer Muse American Museum of Natural History Ward C. Wheeler NJIT Usman Roshan UC Berkeley Satish Rao Steve Evans Richard M Karp Brent Mishler Elchanan Mossel Eugene W. Myers Christos M. Papadimitriou Stuart J. Russell Rice Luay Nakhleh SUNY Buffalo William Piel Florida State University David L. Swofford Mark Holder Yale Michael Donoghue Paul Turner

DNA Sequence Evolution AAGACTT TGGACTTAAGGCCT -3 mil yrs -2 mil yrs -1 mil yrs today AGGGCATTAGCCCTAGCACTT AAGGCCTTGGACTT TAGCCCATAGACTTAGCGCTTAGCACAAAGGGCAT TAGCCCTAGCACTT AAGACTT TGGACTTAAGGCCT AGGGCATTAGCCCTAGCACTT AAGGCCTTGGACTT AGCGCTTAGCACAATAGACTTTAGCCCAAGGGCAT

Phylogeny Problem TAGCCCATAGACTTTGCACAATGCGCTTAGGGCAT UVWXY U VW X Y

Steps in a phylogenetic analysis Gather data Align sequences Estimate phylogeny on the multiple alignment Estimate the reliable aspects of the evolutionary history (using bootstrapping, consensus trees, or other methods) Perform post-tree analyses.

CIPRES research in algorithms Multiple alignment and genomic alignment Heuristics for NP-hard problems (e.g. MP and ML) Statistical performance aspects of phylogeny reconstruction methods under stochastic models of evolution (including novel models) Whole genome phylogeny reconstruction Gene family evolution Reticulate evolution (e.g. horizontal gene transfer and hybridization) detection and reconstruction Data mining on sets of trees, and compact representations of these sets

CIPRES Algorithms Group Tandy Warnow (focus leader) David Bader, Steve Evans, John Huelsenbeck, Warren Hunt, Sampath Kannan, Dick Karp, Paul Lewis, Bernard Moret, Elchanan Mossel, Luay Nakhleh, Christos Papadimitriou, Satish Rao, Usman Roshan, Jijun Tang, Li-San Wang, Tiffani Williams

1.Hill-climbing heuristics for hard optimization criteria (Maximum Parsimony and Maximum Likelihood) Phylogenetic reconstruction methods Phylogenetic trees Cost Global optimum Local optimum 2.Polynomial time distance-based methods: Neighbor Joining, FastME, Weighbor, etc. 3. Bayesian methods

Performance criteria Running time. Space. Statistical performance issues (e.g., statistical consistency) with respect to a Markov model of evolution. “Topological accuracy” with respect to the underlying true tree. Typically studied in simulation. Accuracy with respect to a particular criterion (e.g. tree length or likelihood score), on real data.

Markov models of site evolution Simplest (Jukes-Cantor): The model tree is a pair (T,{e,p(e)}), where T is a rooted binary tree, and p(e) is the probability of a substitution on the edge e The state at the root is random If a site changes on an edge, it changes with equal probability to each of the remaining states The evolutionary process is Markovian More complex models (such as the General Markov model) are also considered, with little change to the theory. Variation between different sites is either prohibited or minimized, in order to ensure identifiability of the model.

Distance-based Phylogenetic Methods

Maximum Parsimony Input: Set S of n aligned sequences of length k Output: –A phylogenetic tree T leaf-labeled by sequences in S –additional sequences of length k labeling the internal nodes of T such that is minimized, where H(i,j) denotes the Hamming distance between sequences at nodes i and j

Maximum Likelihood Input: Set S of n aligned sequences of length k, and a specified parametric model Output: –A phylogenetic tree T leaf-labeled by sequences in S –With additional model parameters (e.g. edge “lengths”) such that Pr[S|(T, params)] is maximized.

1.Hill-climbing heuristics (which can get stuck in local optima) 2.Randomized algorithms for getting out of local optima 3.Approximation algorithms for MP (based upon Steiner Tree approximation algorithms). Approaches for “solving” MP/ML Phylogenetic trees Cost Global optimum Local optimum

Theoretical results Neighbor Joining is polynomial time, and statistically consistent under typical models of evolution. Maximum Parsimony is NP-hard, and even exact solutions are not statistically consistent under typical models. Maximum Likelihood is NP-hard and statistically consistent under typical models.

Theoretical convergence rates Atteson: Let T be a General Markov model tree defining additive matrix D. Then Neighbor Joining will reconstruct the true tree with high probability from sequences that are of length at least O(lg n e max Dij ). Proof: Show NJ accurate on input matrix d such that max{|D ij -d ij |}<f/2, for f equal to the minimum edge “length”.

Problems with NJ Theory: The convergence rate is exponential: the number of sites needed to obtain an accurate reconstruction of the tree with high probability grows exponentially in the evolutionary diameter. Empirical: NJ has poor performance on datasets with some large leaf-to-leaf distances.

Quantifying Error FN: false negative (missing edge) FP: false positive (incorrect edge) 50% error rate FN FP

Neighbor joining has poor performance on large diameter trees [Nakhleh et al. ISMB 2001] Simulation study based upon fixed edge lengths, K2P model of evolution, sequence lengths fixed to 1000 nucleotides. Error rates reflect proportion of incorrect edges in inferred trees. NJ No. Taxa Error Rate

Other standard polynomial time methods don’t improve substantially on NJ (and have the same problem with large diameter datasets). What about trying to “solve” maximum parsimony or maximum likelihood?

Solving NP-hard problems exactly is … unlikely Number of (unrooted) binary trees on n leaves is (2n-5)!! If each tree on 1000 taxa could be analyzed in seconds, we would find the best tree in 2890 millennia #leaves#trees x x x

How good an MP analysis do we need? Our research shows that we need to get within 0.01% of optimal (or better even, on large datasets) to return reasonable estimates of the true tree’s “topology”

Problems with current techniques for MP Average MP scores above optimal of best methods at 24 hours across 10 datasets Best current techniques fail to reach 0.01% of optimal at the end of 24 hours, on large datasets

Problems with current techniques for MP Shown here is the performance of a heuristic maximum parsimony analysis on a real dataset of almost 14,000 sequences. (“Optimal” here means best score to date, using any method for any amount of time.) Acceptable error is below 0.01%. Performance of TNT with time

Empirical problems with existing methods Heuristics for Maximum Parsimony (MP) and Maximum Likelihood (ML) cannot handle large datasets (take too long!) – we need new heuristics for MP/ML that can analyze large datasets Polynomial time methods have poor topological accuracy on large diameter datasets – we need better polynomial time methods

Using divide-and-conquer Conjecture: better (more accurate) solutions will be found if we analyze a small number of smaller subsets and then combine solutions Note: different “base” methods will need potentially different decompositions. Alert: the subtree compatibility problem is NP-complete!

Using divide-and-conquer Conjecture: better (more accurate) solutions will be found if we analyze a small number of smaller subsets and then combine solutions Note: different “base” methods will need potentially different decompositions. Alert: the subtree compatibility problem is NP-complete!

Using divide-and-conquer Conjecture: better (more accurate) solutions will be found if we analyze a small number of smaller subsets and then combine solutions Note: different “base” methods will need potentially different decompositions. Alert: the subtree compatibility problem is NP-complete!

DCMs: Divide-and-conquer for improving phylogeny reconstruction

Strict Consensus Merger (SCM)

“Boosting” phylogeny reconstruction methods DCMs “boost” the performance of phylogeny reconstruction methods. DCM Base method MDCM-M

DCMs (Disk-Covering Methods) DCMs for polynomial time methods improve topological accuracy (empirical observation), and have provable theoretical guarantees under Markov models of evolution DCMs for hard optimization problems reduce running time needed to achieve good levels of accuracy (empirically observation)

Absolute fast convergence vs. exponential convergence

DCM-Boosting [Warnow et al. 2001] DCM+SQS is a two-phase procedure which reduces the sequence length requirement of methods. DCMSQS Exponentially converging method Absolute fast converging method

DCM1 Decompositions DCM1 decomposition : compute the maximal cliques Input: Set S of sequences, distance matrix d, threshold value 1. Compute threshold graph 2. Perform minimum weight triangulation

DCM1-boosting distance-based methods [Nakhleh et al. ISMB 2001] DCM1-boosting makes distance- based methods more accurate Theoretical guarantees that DCM1-NJ converges to the true tree from polynomial length sequences NJ DCM1-NJ No. Taxa Error Rate

Major challenge: MP and ML Maximum Parsimony (MP) and Maximum Likelihood (ML) remain the methods of choice for most systematists The main challenge here is to make it possible to obtain good solutions to MP or ML in reasonable time periods on large datasets

Maximum Parsimony Input: Set S of n aligned sequences of length k Output: A phylogenetic tree T –leaf-labeled by sequences in S –additional sequences of length k labeling the internal nodes of T such that is minimized.

Maximum parsimony (example) Input: Four sequences –ACT –ACA –GTT –GTA Question: which of the three trees has the best MP scores?

Maximum Parsimony ACT GTTACA GTA ACA ACT GTA GTT ACT ACA GTT GTA

Maximum Parsimony ACT GTT GTA ACA GTA MP score = 5 ACA ACT GTA GTT ACAACT MP score = 7 ACT ACA GTT GTA ACAGTA MP score = 4 Optimal MP tree

Maximum Parsimony: computational complexity ACT ACA GTT GTA ACAGTA MP score = 4 Finding the optimal MP tree is NP-hard Optimal labeling can be computed in linear time O(nk)

Problems with current techniques for MP Best methods are a combination of simulated annealing, divide-and-conquer and genetic algorithms, as implemented in the software package TNT. However, they do not reach 0.01% of optimal on large datasets in 24 hours. Performance of TNT with time

Observations The best MP heuristics cannot get acceptably good solutions within 24 hours on most of these large datasets. Datasets of these sizes may need months (or years) of further analysis to reach reasonable solutions. Apparent convergence can be misleading.

How can we improve upon existing techniques?

Our objective: speed up the best MP heuristics Time MP score of best trees Performance of hill-climbing heuristic Desired Performance Fake study

Divide-and-conquer technique for speeding up MP/ML searches

DCM Decompositions DCM1 decomposition : DCM2 decomposition: Clique-separator plus component Input: Set S of sequences, distance matrix d, threshold value 1. Compute threshold graph 2. Perform minimum weight triangulation

But: it didn’t work! A simple divide-and-conquer was insufficient for the best performing MP heuristics -- TNT by itself was as good as DCM(TNT).

Empirical observation DCM1 not as good as DCM2 for MP DCM2 decompositions too large, too slow to compute. Neither improved the best MP heuristics.

How can we improve upon existing techniques?

Tree Bisection and Reconnection (TBR)

Delete an edge

Tree Bisection and Reconnection (TBR)

Reconnect the trees with a new edge that bifurcates an edge in each tree

A conjecture as to why current techniques are poor: Our studies suggest that trees with near optimal scores tend to be topologically close (RF distance less than 15%) from the other near optimal trees. The standard technique (TBR) for moving around tree space explores O(n 3 ) trees, which are mostly topologically distant. So TBR may be useful initially (to reach near optimality) but then more “localized” searches are more productive.

Using DCMs differently Observation: DCMs make small local changes to the tree New algorithmic strategy: use DCMs iteratively and/or recursively to improve heuristics on large datasets However, the initial DCMs for MP –produced large subproblems and –took too long to compute We needed a decomposition strategy that produces small subproblems quickly.

Using DCMs differently Observation: DCMs make small local changes to the tree New algorithmic strategy: use DCMs iteratively and/or recursively to improve heuristics on large datasets However, the initial DCMs for MP –produced large subproblems and –took too long to compute We needed a decomposition strategy that produces small subproblems quickly.

Using DCMs differently Observation: DCMs make small local changes to the tree New algorithmic strategy: use DCMs iteratively and/or recursively to improve heuristics on large datasets However, the initial DCMs for MP –produced large subproblems and –took too long to compute We needed a decomposition strategy that produces small subproblems quickly.

New DCM3 decomposition Input: Set S of sequences, and guide-tree T 1. Compute short subtree graph G(S,T), based upon T 2. Find clique separator in the graph G(S,T) and form subproblems DCM3 decompositions (1) can be obtained in O(n) time (2) yield small subproblems (3) can be used iteratively

Iterative-DCM3 T T’ Base method DCM3

New DCMs DCM3 1.Compute subproblems using DCM3 decomposition 2.Apply base method to each subproblem to yield subtrees 3.Merge subtrees using the Strict Consensus Merger technique 4.Randomly refine to make it binary Recursive-DCM3 Iterative DCM3 1.Compute a DCM3 tree 2.Perform local search and go to step 1 Recursive-Iterative DCM3

Comparison of DCM decompositions (Maximum subset size) DCM2 subproblems are almost as large as the full dataset size on datasets 1 through 4. On datasets 5-10 DCM2 was too slow to compute a decomposition within 24 hours.

Datasets 1322 lsu rRNA of all organisms 2000 Eukaryotic rRNA 2594 rbcL DNA 4583 Actinobacteria 16s rRNA 6590 ssu rRNA of all Eukaryotes 7180 three-domain rRNA 7322 Firmicutes bacteria 16s rRNA 8506 three-domain+2org rRNA ssu rRNA of all Bacteria Proteobacteria 16s rRNA Obtained from various researchers and online databases

Comparison of DCMs (4583 sequences) Base method is the TNT-ratchet. DCM2 tree takes almost 10 hours to produce a tree and is too slow to run on larger datasets. Rec-I-DCM3 is the best method at all times.

Comparison of DCMs (13,921 sequences) Base method is the TNT-ratchet. Note the improvement in DCMs as we move from the default to recursion to iteration to recursion+iteration. On very large datasets Rec-I-DCM3 gives significant improvements over unboosted TNT.

Rec-I-DCM3 significantly improves performance Comparison of TNT to Rec-I-DCM3(TNT) on one large dataset Current best techniques DCM boosted version of best techniques

Rec-I-DCM3(TNT) vs. TNT (Comparison of scores at 24 hours) Base method is the default TNT technique, the current best method for MP. Rec-I-DCM3 significantly improves upon the unboosted TNT by returning trees which are at most 0.01% above optimal on most datasets.

Observations Rec-I-DCM3 improves upon the best performing heuristics for MP. The improvement increases with the difficulty of the dataset.

DCMs DCM for NJ and other distance methods produces absolute fast converging (afc) methods DCMs for MP heuristics DCMs for use with the GRAPPA software for whole genome phylogenetic analysis; these have been shown to let GRAPPA scale from its maximum of about genomes to 1000 genomes. Current projects: DCM development for maximum likelihood and multiple sequence alignment.

Part II: Whole-Genome Phylogenetics A B C D E F X Y Z W A B C D E F

Genomes Evolve by Rearrangements Inverted Transposition –7 –6 –5 – Inversion (Reversal) –8 –7 –6 – Transposition

Genome Rearrangement Has A Huge State Space DNA sequences : 4 states per site Signed circular genomes with n genes: states, 1 site Circular genomes (1 site) –with 37 genes: states –with 120 genes: states

Why use gene orders? “Rare genomic changes”: huge state space and relative infrequency of events (compared to site substitutions) could make the inference of deep evolution easier, or more accurate. Our research shows this is true, but accurate analysis of gene order data is computationally very intensive!

Maximum Parsimony on Rearranged Genomes (MPRG) The leaves are rearranged genomes. Find the tree that minimizes the total number of rearrangement events (NP-hard) A B C D A B C D E F Total length = 18

Optimization problems for gene order phylogeny Breakpoint phylogeny: find the phylogeny which minimizes the total number of breakpoints (NP-hard, even to find the median of three genomes) Inversion phylogeny: find the phylogeny which minimizes the sum of inversion distances on the edges (NP-hard, even to find the median of three genomes)

“Solving” the inversion phylogeny Phylogenetic trees MP score Global optimum Local optimum Usual issue of getting stuck in local optima, since the optimization problems are NP-hard Additional problem: finding the best trees is enormously hard, since even the “point estimation” problem is hard (worse than estimating branch lengths in ML).

Benchmark gene order dataset: Campanulaceae 12 genomes + 1 outgroup (Tobacco), 105 gene segments NP-hard optimization problems: breakpoint and inversion phylogenies (techniques score every tree) 1997: BPAnalysis (Blanchette and Sankoff): 200 years (est.) 2000: Using GRAPPA v1.1 on the 512-processor Los Lobos Supercluster machine: 2 minutes (200,000-fold speedup per processor) 2003: Using latest version of GRAPPA: 2 minutes on a single processor (1-billion-fold speedup per processor)

GRAPPA (Genome Rearrangement Analysis under Parsimony and other Phylogenetic Algorithms) Heuristics for NP-hard optimization problems Fast polynomial time distance-based methods Contributors: U. New Mexico, U. Texas at Austin, Universitá di Bologna, Italy Freely available in source code at this site. Project leader: Bernard Moret (UNM)

Limitations and ongoing research Current methods are mostly limited to single chromosomes with equal gene content (or very small amounts of deletions and duplications). We have made some progress on developing a reliable distance-based method for chromosomes with unequal gene content (tests on real and simulated data show high accuracy) Handling the multiple chromosome case is harder

Other research projects in molecular phylogenetics Many equally good solutions for a given dataset - how can we figure out “truth”? Not all evolution is tree-like - how can we detect and infer reticulate evolution ? How can we visualize large trees, or enable the visualization of differences/similarities between different trees?How can we visualize large trees, or enable the visualization of differences/similarities between different trees? Phyloinformatics -- what database capabilities do we need to utilize phylogenies in biological research ?

Questions Tree shape (including branch lengths) has an impact on phylogeny reconstruction - but what model of tree shape to use? What is the sequence length requirement for Maximum Likelihood? (Result by Szekely and Steel is worse than that for Neighbor Joining.) Why is MP not so bad?

General comments There is interesting computer science research to be done in computational phylogenetics, with a tremendous potential for impact. Algorithm development must be tested on both real and simulated data. The interplay between data, stochastic models of evolution, optimization problems, and algorithms, is important and instructive.

Reconstructing the “Tree” of Life Handling large datasets: millions of species The “Tree of Life” is not really a tree: reticulate evolution

Acknowledgements NSF The David and Lucile Packard Foundation The Program in Evolutionary Dynamics at Harvard The Institute for Cellular and Molecular Biology at UT- Austin Collaborators: Usman Roshan, Bernard Moret, and Tiffani Williams See and for more infohttp://