The PIR-PSD current release 78.03, November 24, 2003, contains 283366 entries. 65 proteins The PIR was established in 1984 by the National Biomedical.

Slides:

Advertisements

Similar presentations

Genome Annotation: A Protein-centric Perspective.

Advertisements

Bioinformatics Ayesha M. Khan Spring 2013.

SWISS-PROT The SWISS-PROT database consists of sequence entries. It contains high-quality annotation, is non-redundant and cross- referenced to many other.

EBI Proteomics Services Team – Standards, Data, and Tools for Proteomics Henning Hermjakob European Bioinformatics Institute SME forum 2009 Vienna.

The design, construction and use of software tools to generate, store, annotate, access and analyse data and information relating to Molecular Biology.

Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную.

Swiss-Prot Protein Database Daniel Amoruso December 2, 2004 BI 420.

Protein databases Morten Nielsen. Background- Nucleotide databases GenBank, National Center for Biotechnology Information.

Introduction to Bioinformatics Burkhard Morgenstern Institute of Microbiology and Genetics Department of Bioinformatics Goldschmidtstr. 1 Göttingen, March.

Archives and Information Retrieval

Protein Databases EBI – European Bioinformatics Institute

Gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta.

Protein databases Henrik Nielsen. Background- Nucleotide databases GenBank, National Center for Biotechnology Information.

Proteins and Protein Function Charles Yan Spring 2006.

Swiss-Prot – одна из первых баз данных белковых последовательностей, “gold standard” белковой аннотации. Аннотация выполнена вручную группой профессиональных.

Gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta.

Class European Resources Protein Focused. Protein Databases EBI – European Bioinformatics Institute

EBI is an Outstation of the European Molecular Biology Laboratory. UniProt Jennifer McDowall, Ph.D. Senior InterPro Curator Protein Sequence Database:

UniProt - The Universal Protein Resource

Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ.

ExPASy - Expert Protein Analysis System The bioinformatics resource portal and other resources An Overview.

Protein Sequence Analysis - Overview Raja Mazumder Senior Protein Scientist, PIR Assistant Professor, Department of Biochemistry and Molecular Biology.

An Introduction to Bioinformatics Molecular Biology Databases.

Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy) Protein Sequence Databases Computational Molecular Biology Biochem 218 – BioMedical.

Joint EBI-Wellcome Trust Summer School June 2010.

Introduction to metabolism: Compounds, Reactions, Enzymes and Pathways Kristian Axelsen, Alan Bridge Elisabeth Coudert & Anne Morgat SIB Swiss Institute.

Bioinformatics.

bioinformatics seminar on BY S.JHANSI RANI MPHARMACY II SEMESTER

Databases in Bioinformatics and Systems Biology Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.

Bioinformatics for biomedicine

Archives and Information Retrieval

Introduction to databases Tuomas Hätinen. Topics File Formats Databases -Primary structure: UniProt -Tertiary structure: PDB Database integration system.

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Discover the UniProt Blast tool. Murcia, February, 2011Protein Sequence Databases Customize the BLAST results.

UniProt Non-redundant Reference Cluster (UniRef) Databases Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EMBL-EBI)

EBI is an Outstation of the European Molecular Biology Laboratory. Annotation Procedures for Structural Data Deposited in the PDBe at EBI.

EBI is an Outstation of the European Molecular Biology Laboratory. Bioinformatics Challenges in Data Handling and Presentation to the Bioinformaticists.

1 EMBL Outstation — The European Bioinformatics Institute Added-Value Proteome Databases: SWISS-PROT, TrEMBL, InterPro.

EMBL-EBI EMBL-EBI EMBL-EBI What is the EBI's particular niche? Provides Core Biomolecular Resources in Europe –Nucleotide; genome, protein sequences,

1 EMBL Outstation — The European Bioinformatics Institute Automatic and Reliable Functional Annotation of Proteins.

1 EMBL Outstation — The European Bioinformatics Institute EDITtoTrEMBL Automated High-Quality Sequence Annotation Steffen Möller, Ulf Leser, Wolfgang Fleischmann,

Protein Information Resource Protein Information Resource, 3300 Whitehaven St., Georgetown University, Washington, DC Contact

Function preserves sequences

PROTEIN DATABASES. The ideal sequence database for computational analyses and data-mining: I t must be complete with minimal redundancy It must contain.

Protein Sequence Analysis - Overview - NIH Proteomics Workshop 2007 Raja Mazumder Scientific Coordinator, PIR Research Assistant Professor, Department.

1 EMBL Outstation — The European Bioinformatics Institute Removing redundancy in SWISS-PROT and TrEMBL.

Copyright OpenHelix. No use or reproduction without express written consent1.

EMBL – EBI European Bioinformatics Institute UniProt - The Universal Protein Resource Claire O’Donovan.

Computer Storage of Sequences

EBI is an Outstation of the European Molecular Biology Laboratory. EBI patent related services Jennifer McDowall Senior Scientist, EMBL-EBI 3 rd Annual.

EBI is an Outstation of the European Molecular Biology Laboratory. UniProtKB Sandra Orchard.

Central hub for biological data UniProtKB/Swiss-Prot is a central hub for biological data: over 120 databases are cross-referenced (EMBL/DDBJ/GenBank,

Bioinformatics Summer School June 2011

1 EMBL Outstation — The European Bioinformatics Institute Mus musculus - a model organism in SWISS-PROT.

? Functional Site rule: tags active site, binding, other residue- specific information Functional Annotation rule: gives name, EC, other activity- specific.

1 EMBL Outstation — The European Bioinformatics Institute Large-Scale Characterization of Protein Sequence Data.

EMBRACE Workshop Appled Gene Ontology ITB – CNR Bari, Italy 7. – 9. November 2007 Domenica D’Elia, Giulia De Sario, Andreas Gisel, Cecilia Saccone, Angelica.

Gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta.

Protein databases Henrik Nielsen

Archives and Information Retrieval

Hood College Master of Science in Bioinformatics (Proposed)

Biological Sequence Databases

생물정보학 Bioinformatics.

UniProt: Universal Protein Resource

UniProt: the Universal Protein Resource

Introduction to Bioinformatics

Protein Sequence Analysis - Overview -

Protein Sequence Analysis - Overview -

Introduction to Databases

SUBMITTED BY: DEEPTI SHARMA BIOLOGICAL DATABASE AND SEQUENCE ANALYSIS.

Presentation transcript:

The PIR-PSD current release 78.03, November 24, 2003, contains entries. 65 proteins The PIR was established in 1984 by the National Biomedical Research Foundation (NBRF) as a resource to assist researchers in the identification and interpretation of protein sequence information.

Swiss-Prot – «золотой стандарт» аннотации Swiss-Prot is a protein knowledgebase established in 1986 and maintained collaboratively, since 1987, by the Department of Medical Biochemistry of the University of Geneva (now the Swiss Institute of Bioinformatics) and the EMBL Data Library (now the EMBL Outstation - The European Bioinformatics Institute (EBI)). The Swiss-Prot protein knowledgebase consists of sequence entries.) Amos Bairoch

Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность

Ttttacctctttttagtgatattgtgatatagagcaaaaatcccgacattgtgtcgggattgtttttaaactcttgttgattttaatttttcaatcgcttctttattaaagaagtagtgtgtgccacaacactcacat tgcatatcaatacggcctttatgttcggctaatatttcgtcaatttcttcatcagagatgagcagtagatgcagaactagaacgctcagcagagcagccacagaaaaattgtacatcttgtgctggataaag attaacggtttcttcgtgatataaacgataggagtaactcttctgcagggagaccaaataattcttcatcttttactgttgctgcgagcgtagttaaatgctcaaaatcttctggtgtaccagaaccatcaggc ataatttgtaataacatacctgctgccactggcttgccttcatattctccagtacgaataattaattgagtttgaagactcatattttcagtgaagtttcgatcgcccttaggaggggccgcgctttctctttcaa GenBankEMBLDDBJ компьютерный поиск гена, трансляция и компьютерная аннотация > п.н. в  последовательностях UniRef (UniProt Non-redundant Reference databases) PIR-PSD UniParc (UniProt Archive)  последовательностей  последовательностей Экспертиза Базы данных научной литературы