WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein

WormBase Web Site

WormBase is a MOD u Model Organism Database u Repository for reagents –Genetic stocks, vectors, clones u Genetic maps u Large-scale data sets –Genome, EST sets, microarrays, interactions u Literature u Meetings, announcements, etc

Other MODs u FlyBase (Drosophila) u WormBase (Caenorhabditis) u SGD (Saccharomyces) u TAIR (Arabidopsis) u MGD (Mus) u PlasmoDB (Plasmodium) u RatDB (Rattus)

C. elegans Fun Facts u 1.5 mm length u 2 week life span u 959 cells u 302 neurons u 6 chromosomes u 100,258,171 bp (95 Ns) u 19,000 genes u 2,000 mutant strains

WormBase Fun Facts u 402,076 Sequences u 121,671 Proteins u 143,708 Clones u 24,728 Primer pairs u 15,022 Papers u 12,552 Loci u 2,944 Cells u 14 Maps u 7,200 RNAi results u 332 Transgenes u 19,713 Expression Patterns

WormBase Tour: Looking for MAP Kinase Kinase

Found a Genetic Locus: mek-2 mek-2 Phenotype & Expr Pattern mek-2 RNAi Studies

mek-2 RNAi Phenotype

mek-2 Sequence View

mek-2 Protein View

mek-2 Genome View

mek-2 PCR Assays

mek-2 Bibliography

mek-2 Citation

VB1 Neuron

VB1 Synapses

VBx Neuroanatomy

Advanced Searches (1)

Advanced Searches (2)

Advanced Searches (3)

Ad Hoc Queries

Bulk FTP Downloads u Genomic sequence –DNA (fasta) –Feature files (GFF) –C. briggsae DNA u ESTs (fasta) u WormPep u Non-coding RNAs u All the software (Open Source)

Recently Added: C. briggsae u C. elegans sequencing consortium (WashU + Sanger Center) u Whole genome shotgun + 12 Mb previously-finished BACs from WashU u 142 scaffolds u N 50 = 1,450 kb u 21,000 predicted genes u 11,000 genes orthologous to elegans

Accessing briggsae via elegansCorresponding region in briggsae

Synteny/Orthology Display

WormBase Usage

WormBase Hits by Domain

Major Referrers

Top Pages

How WormBase Works ACeDB Images, Movies Database access library Web server Perl scripts You MySQL Genomic Data

WormBase Information Workflow.ace SangerCalTechWashUNCBICGC

WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger

WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger CSHL

WormBase Information Workflow.ace SangerCalTechWashUNCBICGC Sanger CSHL CalTech Caltech.wormbase.org

Curating a Paper Database EntryGene Record Cell Record Mutant Record Domain Expert Clipping Service.ACE Files.ACE File CalTechAce

Curating the Genome (1) >CHROMOSOME_I gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaag… List of Features Gene Prediction Repeat Finding EST Alignment

Curating the Genome (2) List of Features ACeDB Sequence Editor CamAce StlAce

CSHLAce Curating Other Data Sets Knockout Consortium GO Consortium C. elegans Microarray Consortium RNAi Labs ORFeome Project

Build Process CamAce StlAceCalTechAceCSHLAce BuildAce WormBase integrate reconcile

The GMOD Project u Generic Model Organism Database u Generic MOD web site u Database schemas u Standard operating procedures u Annotation tools u Analysis tools u Visualization tools

Released Modules u Apollo genome annotation editor u GBrowse generic genome browser u PubSearch literature curation system u LabDoc SOP editor u CMap comparative map viewer u GOET ontology editor u Chado modular database schema

GBrowse

Zoomed Way In

Zoomed Way Way In

Zoomed Way Way Out

Keyword Search

Sequence Search

Third Party Annotations

Links to 3d Party Web Sites

Uploaded Your Own Annotations

Sequence dumps & other reports

Extensively Customizable u End-user –Turn tracks on and off, change order, change packing & labeling attributes (stored in cookie) u Data provider –Change fonts, colors, text. –Change overview – genetic map, contigs, coverage, karyotype. –Define new tracks using simple config file. –Tinker with track appearance to hearts content.

Adding a New Track (a) Create a GFF file named “deletions.gff” Chr1 targeted deletion Deletion d101k2 Chr1 targeted deletion Deletion d680k2 Chr2 targeted deletion Deletion d007k2 (b) Run the load_gff.pl script > load_gff.pl –d example_database deletions.gff Loading features… Done. 3 features loaded. (c) Add a new track “stanza” to the gbrowse configuration file [Knockout] feature = deletion glyph = span fgcolor = red key = Knockouts link = citation = These are deletion knockouts produced by the example knockout consortium (

Extensively Extensible Apache Web Server gbrowse CGI script BioPerl library Bio::DB::GFF adaptor Chado adaptor MySQL Plugins Bio::Graphics library Oracle Oracle adaptor (alpha test) Flat File adaptor Flat Files Glyphs

GBrowse on GenBank? Apache Web Server gbrowse CGI script BioPerl library Plugins Bio::Graphics library Glyphs GenBank Proxy Adaptor GenBank GBrowse on GenBank! Bio::DB::GFF adaptor MySQL

B. burgdorferi via GenBank proxy

WormBase People CalTechCold Spring Harbor Paul SternbergLincoln Stein Erich SchwarzTodd Harris Raymond LeeNansheng Chen Wen XiaoFiona Cunningham Sanger CenterWashington University Richard DurbinJohn Spieth Daniel Lawson Keith Bradman