Western-blotting. Equal amount of protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes. The blots were blocked with 5% non-fat milk and incubated with primary antibody followed with a horseradish peroxidase-conjugated secondary antibody (Sigma, St. Louis, MO). Specific bands were revealed with chemiluminescence substrates (Roche, Nutley, NJ) and recorded with BioSpectrum Imaging System (UVP, Upland, CA). Antibodies to PPP2CA was obtained from CST (Beverly, MA). Antibodies to RAB23 and HNRNPU were from Abcam (Cambridge, MA). RNA oligoribonucleotides and cell transfections. miR-K1 mimic was synthesized by Sigma. The sequences were listed in Supplementary Table 1. Reverse transfection of RNA oligoribonucleotide(s) was done using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s protocol.

2 293T NC miR-K1 PPP2CA HNRNPU Tubulin RAB23 Fig T cells were transfected with synthetic miR-K1 mimic (50 nM). Forty-eight hours after transfection, endogenous protein levels were assessed by Western blot. Tubulin was used as internal controls. NC was used as negative control for miR-K1 mimic.

NameSequence miR mimics miR-K1AUUACAGGAAACUGGGUGUAAGC (sense) UUACACCCAGUUUCCUGUAACUU (antisense) Supplementary Table 1 Sequences of miR-K1 mimic