Family Chlamydiaceae Genus Chlamydia: C. trachomatis Genus Chlamydophilia: C. pneumoniae C. psittaci Chlamydia and Chlamydophila

Chlamydiaceae Obligate intracellular organisms Were once considered virus, true bacteria Contain DNA and RNA Possess ribosomes, synthesize proteins, nucleic acid, and lipids, but cannot synthesize ATP. Binary fission Susceptible to numerous antibiotics, but not to penicillin (lack peptidoglycan) Cell wall: Major outer membrane protein (MOMP) – serological variants (serovars) Outer membrane protein 2 (OMP2) – cysteine-rich protein, structure stability of elementary body (EB)

Unique development cycle Two morphological distinct forms in cytoplasmic phagosome: (1) elementary body ( nm), resistant to harsh environmental factors; bind to receptors of host cells and stimulate uptake; cannot replicate but infectious, (2) reticulate body ( nm), reproductive form, metabolically active, noninfectious. Histologic stains can detect phagosome with accumulated RBs (inclusion)

Nucleus Attachment & Ingestion Phagosome fusion Replication Form Multiplication of (RB) Condensation Extrusion and Life cycle of C. trachomatis RB EB Reticulate Body (RB) Infectious Form Elementary Body (EB) release of EB

1. Chlamydia trachomatis Infections only occur in humans Two biovars and 18 serovars (antigenic differences in MOMP) Biovars Serovars Disease Trachoma A to C Trachoma D to K Urethritis, cervicitis, Inclusion conjunctivitis, Neonatal conjunctivitis, Infant pneumonia LGV L1 to L3 Lymphogranuloma venereum (LGV)

Pathogenesis EBs enter the body via minute abrasions and lacerations Trachoma serovars primarily infect nonciliated epithelial cells (urethra, endocervix, endometrium, fallopian tube, anorectum, respiratory tract, conjunctiva) LGV serovars replicate in mononuclear phagocytes (more invasive); formation of granuloma in lymph nodes draining the site of primary infection, abscesses, or sinus tracts formation

Pathogenesis Direct destruction of cells during replication Proinflammatory cytokine response stimulates a severe inflammation (accumulations of neutrophils, lymphocytes and plasma cells). No long-lasting immunity after infection Re-infection induces a vigorous inflammatory response with subsequent tissue damage (blindness and sterility).

Trachoma A chronic keratoconjunctivitis caused by serovars A, B, Ba, C. Diffuse follicular conjunctivitis → eyelid inward → eyelashes abrade cornea → corneal ulceration → pannus formation (invasion of vessels into the cornea) → blindness Endemic in the Middle East, North Africa, and southern Asia (crowded and poor sanitation regions); predominantly in children. Leading global causes of preventable blindness (>150 million infected, 6 million blinded). Transmission: eye-to-eye by droplet, hands, contaminated clothing, flies.

Urogenital infections Venereal infections caused by serovars of D to K. The most common sexually transmitted bacterial disease in U.S. 2.8 million new cases annually (50 million worldwide). In women: 80% asymptomatic as reservoir; bartholinitis, cervicitis, endometritis, salpingitis, urethritis, which can lead to sterility and ectopic pregnancy. In men: 25% asymptomatic; nongonococcal urethritis (NGU; urethritis caused by pathogens other than gonococcus )

Nongonococcal Urethritis (NGU) C. trachomatis (35-50% of cases) Ureaplasma urealyticum (10-30% of cases) Mycoplasma hominis Gardnerella vaginalis Trichomonas vaginalis Candida albicans

Dual infections of C. trachomatis and Neisseria gonorrhoeae are common. Post-gonococcus urethritis Symptoms of chlamydial infection develop after successful treatment of gonorrhea. Reason: longer incubation period + β -lactam antibiotics are ineffective for C. trachomatis Reiter’s syndrome Urethritis, conjunctivitis, polyarthritis, mucocutaneous lesion Usually occurs in young white man Initiated by genital infection with C. trachomatis.

Adult Inclusion Conjunctivitis Acute follicular conjunctivitis with mucopurulent discharge Mostly occur in sexually active adults ( yr) with genital infection with serotypes A, B, Ba, D to K. Acquired by auto-inoculation, oral-genital contact

Newborn Inclusion Conjunctivitis 25% infants acquired from mothers with active genital infections Swollen and hyperemic eyelids Long (>12 months) disease course if untreated and are at risk for C. trachomatis pneumonia

Infant Pneumonia A diffuse interstitial pneumonia Occur in 10-20% infants that exposed to the pathogen at birth Rhinitis → staccato cough

Lymphogranuloma venereum (LGV) A chronic sexually transmitted disease caused by C. trachomatis L1, L2, L2a, L2b, L3. More common in men, with male homosexuals being the major reservoir. Small, painless lesions (papule or ulcer) at site of infection (genitalia). Fever, headache, myalgia. Inflammation and swelling of regional lymph nodes (inguinal nodes), painful buboes, rupture, fistulas formation. Proctitis is common in women. Resolve spontaneously or progress to ulceration or genital elephantiasis

Lab diagnosis Symptomatic infections are easier to diagnosis than asymptomatic infections as more chlamydiae present in specimen. Cytology – Giemsa-stained cell scrapings Quality of the specimen is important. Specimens must be obtained from the involved site; pus or exudate is inadequate. Insensitive, nonspecific Culture – HeLa, MaCoy, Hep-2 cells Iodine stain to detect inclusions (=RBs) The most specific methods for diagnosis. Sensitivity depends on quality and quantity of specimen.

Iodine-stained Chlamydia trachomatis inclusion bodies (arrows)

Lab diagnosis Fluorescent antibody assay Frei test (delayed hypersensitivity) for LGV Growth in tissue culture DNA probe test PCR

DNA purification PCR (DNA amplification) Hybridization (Oligo-probes) PCR-SB Cryptic plasmid –PCR hybridization assay C. trachomatis new detection method

DNA purification Phenol-CIA method

Cryptic plasmid CPF CPR PCR (DNA amplification) Two primers named CT-CPF: 5' ‑ TGATTGTACAAGGGATCCGTAAGT ‑ 3' (start at nt. 7089) and CT-CPR: 5' ‑ TCGATGAAAGACAGGAAATACG ‑ 3' (end at nt. 7465) (X07547, GenBank) Amplify 376 bps homology to some other genes of Human, Drosophila melanogaster and S.cerevisiae.

C. trachomatis-specific anti-sense probe named CP35 (nt nt. 7360) Hybridization (Oligo-probes) The oligoprobe, CP-35 has also sequence homology in many sequences of human.

Comparison of the results with PCR-microwell plate (MWP) assay and the PCR-SB assay using serially diluted positive sample Dilution of a positive sample Amplicore MWP (OD) PCR - SB 400 (bps) 300 (bps)

Comparison of the results with IDEIA, PCR-MWP and PCR-SB assays in 16 samples from urethritis patients Amplicore MWP (OD) PCR - SB Case No. IDEIA Agarose gel 300 (bps) 400 (bps)

T/P/C Doxycycline for LGV Azithromycin or doxycycline for ocular and genital infections in adult Erythromycin for newborn conjunctivitis and pneumonia Improve sanitary conditions – essential for prevention Safe sex practices

2. Chlamydophilia pneumoniae Was first isolated from the conjunctiva of a child in Taiwan - TWAR strain. An important cause of sinusitis, pharyngitis, bronchitis, and pneumonia. Infection is common, especially in adults and transmitted person-to-person by respiratory secretions.

Clinical disease Most infections are asymptomatic or mild - persistent cough. Cannot be differentiated with other atypical pneumonia - Mycoplasma pneumoniae, Legionella pneumophila, and respiratory viruses. Detected in atherosclerotic lesions in blood vessels. However, the role in the development of atherosclerosis is not clear.

Lab diagnosis Diagnosis is difficult Do not grow in cell lines used for isolation of C. trachomatis NAATs are OK with large interlaboratary variation. Micro-immunofluorescence (MIF) test The only acceptable serodiagnotic test (specific) A single IgM titer > 1:16 or a fourfold increase in IgG titer Nucleic Acid Amplification Techniques (NAAT)

T/P/C Ubiquitous present, control is difficult Macrolides (erythromycin), doxycycline

3. Chlamydophilia psittaci Caused Psittacosis (parrot fever). The natural reservoir is any species of birds Can infect sheep, goat, cows, and humans (zoonosis) High risk groups: veterinarians, zookeepers, pet shop workers, employees of poultry industry.

Pathogenesis Inhalation of dried bird excrement, urine, or respiratory secretions; person-to-person transmission is rare. Bacteria first spread to and multiply in reticuloendothelial cells of liver and spleen  necrosis Then hematogenous spread to lung and other organs via circulation Lmphocytic inflammation in lung, edema, necrosis, mucous plugs in bronchioles  cyanosis and anoxia

Clinical disease Asymptomatic infection Flu-like illness: high fever, headache, chills, myalgia Serious pneumonia: non-productive cough, rales, consolidation, CNS involvement: common (headache, encephalitis, convulsion, coma) GI symptoms: nausea, vomiting, diarrhea (carditis, hepatomegaly, splenomegaly)

Diagnosis and treatment for C. psittaci Complement fixation test of paired acute and convalescent phase sera Confirmed by species-specific MIF test Treatment: tetracyclines or macrolides No need of isolation of patients and prophylaxia No vaccine available Treat birds with chlortetracycline HCl for 45 days.

Rickettsia and Orientia Ehrlichia, Anaplasma, Coxiella RickettsiaHoward Ricketts EhrlichiaPaul Ehrlich CoxiellaHarold Cox (Historically classified in Rickettsiaceae)

Order Rickettsiales Family Rickettsiaceae Genera Rickettsia Orientia Family Anaplasmataceae Genera Ehrlichia Anaplasma Neorickettsia Wolbachia

Obligate intracellular parasites. G(-) bacilli, with a minimal peptidoglycan layer (stain poorly with Gram stain) and LPS (weak endotoxin activity) Maintain in animal and arthropod reservoirs (by transovarian transmission). Transmitted to humans by arthropod vectors (ticks, mites, lice, fleas). Humans are accidental hosts: acquired by arthropod bite or contact of arthropod excreta with abraded skin Rickettsia and Orientia

Rickettsia (also Ehrlichia) is unstable and die quickly outside host cells. Coxiella highly resistant to desiccation, remain viable in environment for months to years. After phagocytosis Rickettsia and Orientia: degrade phagosome membrane by producing phospholipase, multiply in cytoplasm and nucleus of endothelial cells Ehrlichia and Anaplasma: multiply in cytoplasmic vacuoles (=phagosomes) of hematopoietic cells Coxiella: multiply in phagolysosome of monocytes and macrophages

Important Rickettsial Diseases Spotted fever group (17 species related to human diseases) R. rickettsii RMSF (>90%) R. akari Rickettsialpox (100%) Typhus group R. prowazekii Epidemic typhus (40-80%) R. typhi Murine typhus (50%) O. tsutsugamushi Scrub typhus (<50%) (Parentheses: % of rash, The distribution of rickettsial diseases (restricted area or worldwide) is determined by the distribution of the arthropod hosts/vectors. Rocky Mountain spotted fever (RMSF)

Pathogenesis No toxins, no immunopathology OmpA mediated binding to endothelial cells Rickettsia replicate in endothelial cells, cause cell damage and blood leakage, vasculitis, skin rash, microthrombi, focal ischemia, hemorrhage. Hypovolemia, hypoproteinemia, reduced perfusion, organ failure.

Rocky mountain spotted fever Have a restricted geographic and seasonal distribution, corresponding to tick activity. R. rickettsii is maintained in hard ticks (wood tick and dog tick) by transovarian transmission. Transmitted to humans by tick bite (need >6h to establish infection). High fever, chills, headache, skin rash (>90%, extremities to trunk) Respiratory failure, encephalitis, renal failure.

Rocky mountain spotted fever Have a restricted geographic and seasonal distribution, corresponding to tick activity. R. rickettsii is maintained in hard ticks (wood tick and dog tick) by transovarian transmission. Transmitted to humans by tick bite (need >6h to establish infection). High fever, chills, headache, skin rash (>90%, extremities to trunk) Respiratory failure, encephalitis, renal failure.

Diagnosis is urgent, the prognosis depends on the duration of illness (identify key clinical signs – rash); fatality 10-25% if untreated Culture: buffy coat of blood or skin biopsy; tissue culture or embryonated eggs (danger) Microscopy: Giemsa stain; FA for biopsy tissue specimens (rapid and specific) Serology: microimmunofluorescence (MIF), detect antibodies against MOMP and LPS antigens; both specific and sensitive Nucleic acid-based tests: PCR + gene sequencing of a variety of genes The traditional Weil-Felix test: not recommended for use

Treatment /Prevention/Control: Appropriate therapy would result in good prognosis (e.g., doxycycline) No vaccine Prevent tick bites (can survive for as long as 4 years without feeding)

Rickettsialpox R. akari Infections are transmitted to humans from rodents reservoir by bite of infected mites (transovarian transmission) Cosmopolitan distribution (New York City) Clinical disease – biphasic Papule at site of bite, ulceration, eschar formation (differentiate with cutaneous anthrax) High fever, severe headache, chills, sweats, myalgias, photophobia, generalized rash (100%), complete healing 2-3 wks.

Epidemic (louse-borne) typhus R. prowazekii Humans are the primary reservoir with person-to-person transmission by human louse (the bacteria kill the lice 2 to 3 wk after infection; no transovarian transmission). Epidemics occur among people living in crowded, unsanitary condition - war, famine, or natural disaster. High fever, severe headache, myalgias, skin rash (20-80%), complete recovery >3 months

Brill-Zinsser Disease Bacteria may remain for years. A recrudescent, mild form of epidemic typhus arising years after the initial attack.

Diagnosis: MIF test T/P/C: Tetracyclines, Chloramphenicol Louse-control A formaldehyde-inactivated vaccine is available

Endemic (murine) typhus R. typhi transmits to man from rodent reservoir hosts by the bite of rat flea and cat flea. Endemic all over the world, primarily in warm, humid areas. Fever, severe headache, myalgias, chills, skin rash (50%) on chest and abdomen for 3 weeks.

Diagnosis: IFA test T/P/C: Tetracyclines Pest control No vaccine

Scrub typhus Caused by Orientia tsutsugamushi Transmitted to humans by red mites (chiggers) Organisms are maintained in mites by transovarian transmission. Endemic in eastern Asia, Australia, and Japan. Fever, severe headache, myalgias, skin rash (<50%), spread centrifugally to extremities. Generalized lymphadenopathy, splenomegaly, CNS complication, heart failure

T/P/C: Prompt treatment with doxycycline Avoid exposure to chiggers No vaccine

Ehrlichia, Anaplasma, Coxiella

Ehrlichia and Anaplasma Intracellular bacteria that lodge in phagosomes of mononuclear and granulocytic phagocytes, but not RBC. Grow cycle: three stages - elementary body, reticulate body, morulae in phagosome (can be detected by Giemsa or Wright stains) Ehrlichia inclusions (peripheral blood smear, Wright-Giemsa)

Clinical disease 1. Human monocytic ehrlichiosis E. chaffeensis : infect monocytes and mononuclear phagocytes Vector - Lone Star tick, no transovarian transmission Reservoir - white-tailed deer, domestic dogs, foxes, coyotes, wolves Humans are accident host

2. Canine granulocytic ehrlichiosis E. ewingii: infect granulocytes Vector - Lone Star tick Reservoir -white-tailed deer, domestic dogs Humans are accident host 3. Human anaplasmosis Anaplasma phagocytophilum : infect neutrophils, eosinophils, and basophils Vector - Ixodes ticks Reservoir - small mammals

Clinical disease Fever, headache, malaise, myalgias, leukopenia, thrombocytopenia, elevated transaminases Skin rash (10 to 40%) 50% patients require hospitalization, 2 to 3% mortality

Diagnosis Diagnosis is urgent. Stain poorly with Gram stain. Giemsa stain of blood smear for moralae monocytic ehrlichiosis: 10% (+) granulocytic ehrlichiosis and anaplasmosis: 20-80% (+) DNA amplification test: specific and sensitive Serology: cross-reactivity

T/P/C: Prompt treatment with doxycycline No vaccine available Avoid tick-infested areas

Coxiella burnetii Biologically and genomically distinct from Rickettsia; more closely related to Legionella. Obligate intracellular pathogen Small cell variants (SCV): extremely resistant to environmental stress, infectious form Large cell variants (LCV): multiply in phagolysosome in monocytes or macrophages

Epidemiology Can infect mammals, birds, and ticks Primary reservoirs: farm animals, cats, dogs, rabbits Ticks are vector for disease in animals but not in humans Zoonosis

Epidemiology Extremely stable in harsh environmental conditions; are able to survive in soil and milk for months to years. Infection is common in livestock, but symptomatic disease is rare. High concentrations of bacteria are present in placenta of infected livestock. Transmit to man by the respiratory route from contaminated soil or ingestion of contaminated unpasteurized milk, not from arthropod vector. Ranchers, veterinarians, and food handlers are at highest risk.

Pathogenesis Target tissue is the lung, proliferate in phagolysosomes of infected cells, then disseminate to other organs Undergo antigenic variation (cell wall LPS): Infectious forms possess phase I antigen: LPS with a complex carbohydrate, can block antibody binding phase II antigen is the product of the gene of phase I antigen after deletion: a modified LPS, expose surface proteins to antibody

Q fever Most infections are mild or asymptomatic Acute disease: Mild, flulike, <5% requires hospitalization Fever, pneumonia, hepatitis, diffuse granulomas in involved organs Chronic disease: subacute endocarditis exclusively in patients with valvular heart disease or immunosuppression; mortality 65% if untreated

Diagnosis Serologic tests (IFA, ELISA, CF) Acute Q fever: antibodies are developed primarily against phase II antigen. Chronic Q fever: antibodies against both phase I and II antigens are elicited. (phase I antigen: weak antigenic)

T/P/C: Doxycycline for prolonged period Vaccines are available single dose with no booster immunization for uninfected people for adverse reaction will happen in previously infected individuals.

200 species; 16 colonize humans Mycoplasma M. pneumoniae M. hominis M. genitalium Ureaplasma U. urealyticum Mycoplasma and Ureaplasma

Smallest (  m) and simplest free-living bacteria (about twice the genome size of certain large viruses) Small, fried-egg-like colonies (except M. pneumoniae)

Lack a cell wall Highly pleomorphic shapes Resistant to penicillin, cephalosporins, vancomycin, but sensitive to tetracycline, erythromycin. Cell membrane contains sterols - rigid Anaerobic (except M. pneumoniae) Grow slowly in cell-free media, need sterols, use glucose as a source of energy (ureaplasmas require urea)

Epidemiology M. pneumoniae Strict human pathogen Worldwide disease with no seasonal incidence Most common in school-age children and young adults (5-15y), but all age groups are susceptible Spread by respiratory droplets during coughing episodes in close contact among classmate or family members

U. urealyticum, M. hominis, and M. genitalium Infants (females) are colonized with the agents Carriage does not persist. Only a small proportion of prepubertal children remains colonized The incidence of genital mycoplasmas is associated with sexual activity Sexually active men and women 15% with M. hominis and 45-75% with Ureaplasma

Extracellular pathogen; infect and colonize mucous membrane (nose, throat, trachea, LRT). Pathogenesis - M. pneumoniae Adheres to sialated glycoprotein receptor (1) at the base of cilia, (2) on surface of RBC by means of P1 antigen.

The mechanism of cellular damage is unknown (produce peroxide and hemolyze RBC?) Causes ciliostasis, destroy cilia and ciliated epithelial cells; breakdown clearance activity, lead to LRT infection and persistent cough. M. pneumoniae contains superantigen, can attract inflammatory cells and induce cytokine secretion (TNF, IL-1, IL-6).

Clinical disease - M. pneumoniae Mostly asymptomatic carriage Cause mild URT disease (acute pharyngitis), low- grade fever, malaise, headache, dry and nonproductive cough, persist for > 2 weeks Tracheobronchitis with lymphocyte and plasma cell infiltration, atypical (walking) pneumonia Secondary complication: hemolytic anemia, arthritis, myocarditis, pericarditis, neurologic abnormalities (e.g., meningoencephalitis)

Typical pneumonia - bacterial pneumonia Sudden, rigorous onset Productive cough, purulent sputum High fever, chest pain, stiffness in the neck Chest consolidation Murray, et.al: Textbook of Respiratory Medicine

Atypical (walking) pneumonia Chronic in both onset and recovery Flulike symptomes - generalized aches, discomfort, headache, chill, dry cough, low- grade fever Chest radiographs: patchy broncho-pneumonia, interstitial pattern, not pneumonia Murray, et.al: Textbook of Respiratory Medicine

Diseases caused by U. urealyticum and M. genitalium and M. hominis M. genitalium : nongonococcal urethritis (NGU), pelvic inflammatory disease U. urealyticum : NGU, pyelonephritis, abortion, premature birth M. hominis : pyelonephritis, postpartum fever, systemic infection in immunocompromised patients

Lab diagnosis Culture of mycoplasmas is not routinely attempted, and relatively insensitive M. pneumoniae can grow in special medium with animal serum (sterols), yeast extract (nucleic acid), glucose, pH indicator, and penicillin. Colonies have a “mulberry-shaped”. M. hominis requires arginine for growth. Colonies have a fried-egg appearance. Ureaplasma requires urea for growth Microscope: no cell wall, stain poorly, no value

Serology – for M. pneumoniae only Complement fixation test : high false-positive rate ELISA for detection of IgM and IgG Abs, more sensitive; need dual serum samples Cold agglutinins: IgM Abs that bind the I antigen on human RBC (type O) at 4°C, develop in 65% of the patients – insensitive and nonspecific. PCR

Treatment / Prevention / Control M. pneumoniae: erythromycin, tetracycline (also good for chlamydia) Ureaplasma: use erythromycin, resistant to tetracycline M. hominis: resistant to erythromycin and tetracycline, use clindamycin Avoidance or safe sex for genital mycoplasma No vaccine available

lice (louse) قمل

Ticks قراد

Mites

Fleas