CHAPTER 14: Genes in Action Essential Questions: 1.What is a Mutation? 2. What Causes Mutation? 3. What is the origin of genetic differences among organisms? 4. What types of mutations are possible? 5. How can genetic change occur on a larger scale? 6. How will Modern Technology in DNA affect us?

Gene Mutations 1. A Mutation is a change in the sequence of DNA bases within a gene 2. What Causes Mutations: Mutations can be spontaneous or caused by environmental influences called mutagens. Mutagens include radiation (X-rays, UV radiation), and organic chemicals (in cigarette smoke and pesticides).

Origins of Genetic Difference Origins of Genetic Difference 3. MUTATION is the origin differences among organisms For the most part, genetic differences among organisms originate as some kind of mutation. A genetic mutant is an individual whose DNA or chromosomes differ from some previous or normal state. Every unique allele of every gene began as a mutation of an existing gene. In genetics, a mutation is a change in the structure or amount of the protein produced

Effects of Mutations –Because of the way DNA is translated, a mutation can have many possible effects. –A mutation may have no effect, or may harm or help in some way. –Mutations are noticed when they cause an unusual trait or disease, such as sickle cell anemia. –Many mutations may go unnoticed.

Mutations Changes to DNA are called mutations change the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

Types of mutations 4. Changes to the letters (A,C,T,G bases) in the DNA can result in 2 types of mutation Point mutation change to ONE letter (base) in the DNA may cause change to protein, may not Frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA Both shift the DNA so it changes how the codons are read BIG changes to protein

Types of Point Mutations 1. Silent mutation - the change in the codon results in the same amino acid Ex: UAU  UAC both code for tyrosine 2. Nonsense mutation - a codon is changed to a stop codon; resulting protein may be too short to function Ex: UAC  UAG (a stop codon) 3. Missense mutation - involves the substitution of a different amino acid, the result may be a protein that cannot reach its final shape Ex: Hbs which causes sickle-cell disease

Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

Point Mutations One base change THEFATCATANDTHEREDRATRAN can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

Mutations as Changes in Results of Genes –Changes in a DNA sequence may affect the results of genes in many ways. –A mutation is silent when it has no effect on a gene’s function. –Point mutations are often silent because the genetic code is redundant (each amino acid has multiple codons). –A missense or replacement mutation results when a codon is changed such that the new codon codes for a different amino acid.

Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

Frameshift Mutations The reading frame of a sequence depends on the starting point for reading. An insertion or deletion can shift the reading frame, or cause a frameshift. In frameshift mutations, the remaining sequence may be “read” as different codons. An insertion or deletion of many codons is likely to disrupt the resulting protein’s structure and function.

Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

Deletion Mutation:Cystic Fibrosis Loss of one amino acid!

LARGE-SCALE GENETIC CHANGE 5. How can genetic change occur on a larger scale? Very large-scale genetic change can occur by misplacement, recombination, or multiplication of entire chromosomes.

Chromosomal Mutations During meiosis, chromosomes pair up and may undergo crossover. Usually, the result is an equal exchange of alleles between homologous chromosomes. Errors in the exchange can cause chromosomal mutations.

Changes in Chromosome Structure Chromosome mutation - a change in chromosome structure 4 Types of chromosomal mutations: Inversion Translocation Deletion Duplication

Chromosomal Deletion: Williams Syndrome Deletions occur when a single break causes a lost end piece, or two breaks result in a loss in the interior. Children have a pixie look (turned-up noses, wide mouth, small chin, large ears) Poor academic skills, good verbal and musical abilities. Skin ages prematurely from lack of the gene that controls the production of elastin (also affects cardiovascular health).

Chromosomal Duplication: Dup15 Duplication results in a chromosome segment being repeated in the same chromosome An inverted duplication in chromosome 15 causes Dup 15 syndrome Poor muscle tone, mental retardation, seizures, curved spine, and autistic characteristics

Chromosome Translocation : Alagille Syndrome Translocation is exchange of chromosomal segments between two, non-homologous chromosomes. Ex: Alagille syndrome results from a deletion of chromosome 20 or a translocation that disrupts an allele on chromosome 20. Distinctive face, abnormalities of eyes & internal organs, and severe itching.

Chromosome Inversion Inversion involves a segment of a chromosome being turned 180 degrees The reverse sequence of alleles can alter gene activity. Crossing-over between inverted and normal chromosomes can cause duplications and deletions

Changes in Chromosome Number Nondisjunction – occurs when: In meiosis I, homologous pair both go into the same daughter cell or in meiosis II, the sister chromatids both go into the same gamete. Example: Trisomy 21 Down syndrome is a genetic disorder caused by the presence of all or part of a third copy of chromosome 21. It is associated with growth delays, and mild to moderate intellectual disability.

EFFECTS OF GENETIC CHANGE •What are the possible effects of mutations? The results of genetic change may be harmful, beneficial, or neutral; most changes are neutral and may not be passed on to offspring. Most genetic changes will cause no change in the appearance or function of organisms. •Mutations that occur in gametes can be passed on to offspring, but mutations in body cells affect only the individual in which they occur.

Some Common Genetic Diseases Huntington’s Disease: Autosomal dominant Neuromuscular disease; degeneration of muscle, onset in early 30’s. Cystic Fibrosis: Autosomal Recessive; Defective Protein is made that creates excess mucus; clogs lungs. Color Blindness: Sex-linked recessive Inablity to distinguish colors (8% of male population) Hemophilia: Sex-linked recessive Inablity of blood to clot Muscular Dystrophy: Sex-linked recessive Loss of muscle that begins in early childhood Tay-Sach’s Disease : Autosomal Recessive Degeneration of Central Nervous System; infant mortality

DNA Technology and Modern Medicine The Human Genome Project Decoded an entire length of DNA in 2003 The Genetic Sequencing allows for improvements in the detection and treatment of genetic disease and cancer. Gene Therapy is a technology in which good copies of a gene are introduced into those individuals affected by genetic disease