Elements of Molecular Biology All living things are made of cells All living things are made of cells Prokaryote, Eukaryote Prokaryote, Eukaryote

Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, … Nucleus, chromosomes, genes, … Human genome is around 3 billions base pair long Human genome is around 3 billions base pair long Almost every cell in human body contains same set of genes Almost every cell in human body contains same set of genes But not all genes are used or expressed by those cells But not all genes are used or expressed by those cells

Terminology Genome is an organism’s complete set of DNA. Genome is an organism’s complete set of DNA. a bacteria contains ~ 600,000 DNA base pairs a bacteria contains ~ 600,000 DNA base pairs human and mouse genomes have some 3 billion. human and mouse genomes have some 3 billion. Chromosomes Chromosomes Human genome has 23 distinct pairs of chromosomes (22 pairs of autosomes and one pair of sex chromosomes). Human genome has 23 distinct pairs of chromosomes (22 pairs of autosomes and one pair of sex chromosomes). Each chromosome contains many genes. Each chromosome contains many genes. Gene Gene basic physical and functional units of heredity. basic physical and functional units of heredity. specific sequences of DNA bases that encode instructions on how to make proteins. specific sequences of DNA bases that encode instructions on how to make proteins. Genotype: Genetic makeup of an organism Genotype: Genetic makeup of an organism Phenotype: Physical expressed traits of an organism Phenotype: Physical expressed traits of an organism

Elements of Molecular Biology All Life depends on 3 critical molecules All Life depends on 3 critical molecules DNA DNA Hold information on how cell works Hold information on how cell works RNA RNA Act to transfer short pieces of information to different parts of cell Act to transfer short pieces of information to different parts of cell Provide templates to synthesize into protein Provide templates to synthesize into protein Proteins Proteins Form enzymes that send signals to other cells and regulate gene activity Form enzymes that send signals to other cells and regulate gene activity Form body’s major components (e.g. hair, skin, etc.) Form body’s major components (e.g. hair, skin, etc.) Central dogma Central dogma

the national health museum O C DNADNA DNA is composed of four nucleotides or "bases": A,T,C,G 3 rd C 5 th C

Note that A pairs with T; and C pairs with G. DNA Four types of nucleotides of DNA

DNA Structure 3’5’

RNA RNA composed of four bases: A,C,G,U (T transcribed as U)

Proteins Amino Acid

Proteins are composed of amino acids Basic Amino Acid Structure: Basic Amino Acid Structure: The side chain, R, varies for each of the 20 amino acids The side chain, R, varies for each of the 20 amino acids C R CC H N O OH H H Amino group Carboxyl group Side chain

Protein

Central Dogma of Molecular Biology DNA  RNA  protein DNA  RNA  protein Sequence  structure  function Sequence  structure  function

Central Dogma DNARNAprotein transcription translation A string of the alphabet {A,C,G,T} Ex. CCTAAGA A string of the alphabet {A,C,G,U} Ex. CCUAAGA A string of the alphabet {20 amino acids} Ex. TGFIKYL Gene expression

DNA to RNA to Protein A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis

Transcription

TranscriptionTranscription Transcription is accomplished by RNA polymerase Transcription is accomplished by RNA polymerase RNA polymerase binds to promoters RNA polymerase binds to promoters promoters have distinct regions "-35" and "-10" promoters have distinct regions "-35" and "-10" efficiency of transcription controlled by binding and progression rates efficiency of transcription controlled by binding and progression rates transcription start and stop affected by secondary structure transcription start and stop affected by secondary structure regulatory sequences can be positive or negative regulatory sequences can be positive or negative

Translation (animation) animation

TranslationTranslation conversion from RNA to protein is by codon: 3 bases = 1 amino acid conversion from RNA to protein is by codon: 3 bases = 1 amino acid translation done by ribosome and tRNA translation done by ribosome and tRNA translation efficiency controlled by mRNA copy number (turnover) and ribosome binding efficiency translation efficiency controlled by mRNA copy number (turnover) and ribosome binding efficiency translation affected by mRNA tertiary structure translation affected by mRNA tertiary structure

More on Translation the national health museum

Start: AUG Stop: UAA, UAG, UGA

Biology, 7/c, Peter H. Raven Gene expression Gene expression hill.com/sites/ /student_view0/chap ter18/animations.html# hill.com/sites/ /student_view0/chap ter18/animations.html#

Exercise Translate the following DNA to a protein: Translate the following DNA to a protein: …ctatgcccaagctgaaaaatgagcgtaatgaggtcatcat… -3’ …gatacgggttcgactttttactcgcattactccagtagta… -5’ template

The Human Genome Project The human genome sequence is complete - - approximately 3 billion base pairs.

Whole genome sequencing has now become routine

How does the human genome stack up? Organism Genome Size (Bases) Estimated Genes Human (Homo sapiens) 3.2 billion 25,000 Laboratory mouse (M. musculus) 2.6 billion 25,000 Mustard weed (A. thaliana) 100 million 27,000 Rice (Oryza sativa) 430 million 50,000 Roundworm (C. elegans) 97 million 19,000 Fruit fly (D. melanogaster) 137 million 13,000 Yeast (S. cerevisiae) 12.1 million 6,000 Bacterium (E. coli) 4.6 million 4.6 million3,200 Human immunodeficiency virus (HIV) H1N U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

The Path Forward How does DNA impact health? How does DNA impact health? Identify and understand the difference in DNA sequence among human populations Identify and understand the difference in DNA sequence among human populations What do all the genes do? What do all the genes do? Discover the functions of human genes by experimentation and by finding genes with similar funcs in the model organisms Discover the functions of human genes by experimentation and by finding genes with similar funcs in the model organisms What are the functions of nongene areas? What are the functions of nongene areas? Identify important elements in the nongene regions of DNA Identify important elements in the nongene regions of DNA How does info in the genome enable life? How does info in the genome enable life? Explore life at the ultimate level of the whole organism instead of single genes/proteins. Explore life at the ultimate level of the whole organism instead of single genes/proteins. U.S. Department of Energy, 2005

Diverse applications Medicine – customized treatments, … Medicine – customized treatments, … Microbes for energy and the environment – generate clean energy source, clean up toxic wastes,… Microbes for energy and the environment – generate clean energy source, clean up toxic wastes,… Bioanthropology – human lineage Bioanthropology – human lineage Agriculture, livestock breeding, Bioprocessing – crops&animals more resistant to diseases, efficient industrial processes,… Agriculture, livestock breeding, Bioprocessing – crops&animals more resistant to diseases, efficient industrial processes,… DNA identification – implicate people accused of crimes, identify contaminants in air, water, … DNA identification – implicate people accused of crimes, identify contaminants in air, water, … U.S. Department of Energy, 2005

Homework - Quiz on Wednesday Terminology: genome, genes, proteins, Nucleic acid, amino acids, DNA, RNA, mRNA, tRNA, rRNA, mutation, chromosomes, genotype, phenotype, codon, … Terminology: genome, genes, proteins, Nucleic acid, amino acids, DNA, RNA, mRNA, tRNA, rRNA, mutation, chromosomes, genotype, phenotype, codon, … DNA structures, RNA structures, direction of DNA sequence, DNA replication DNA structures, RNA structures, direction of DNA sequence, DNA replication Central dogma of molecular biology, transcription, translation Central dogma of molecular biology, transcription, translation …