Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes. Let’s look at a few of these…

1. ARTIFICIAL BREEDING/SELECTION Artificial Breeding/Selection is … z.about.com michaeldodsracing.co.uk When humans select who mates to whom to improve the breed.

Artificial Breeding/Selection Artificial Breeding/Selection is … When humans select which plants to cross to improve the plant. Wild mustard plant Wild rose plant Wild corn called TEOSINTE was bred to create today’s corn nescent.org

Artificial Breeding/Selection What if humans selected which humans to mate?! Mother Teresa? static.howstuffworks.com Venus Williams? 2009.wimbledon.org Rosalind Franklin? gandt.blogs.brynmawr.edu Angelina Jolie? ?

2. BIOTECHNOLOGY Biotechnology is … The use of organisms or their products to improve human life. HOW DO THEY DO IT?! biotechresearchandfinance.com

The code is UNIVERSAL! Since all living organisms… – use the same DNA – use the same code book – read their genes the same way Since all living organisms… – use the same DNA – use the same code book – read their genes the same way Remember that ALL organisms are made using the same four DNA bases A,T,C,G. AND Those bases code the same way in ALL organisms using A,U,C,G. Remember that ALL organisms are made using the same four DNA bases A,T,C,G. AND Those bases code the same way in ALL organisms using A,U,C,G.

CLONING = making genetically identical copies HSW: Genetics: CloningHSW: Genetics: Cloning Time: 03:20 Reversing Human Destruction through Cloning /index.cfm?guidAssetId=4CDB02CD B4-AF9D- B940E1393F19&blnFromSearch=1 &productcode=US The Controversy

Let’s look at Dolly

Human Genome Project Identified the entire sequence of DNA bases for humans. Human Genome Project Identified the entire sequence of DNA bases for humans. There are 3.2 billion bases in the human genome. What do you think can be done now that we know the order (sequence) in which all 3.2 billion bases occur? Human Genome Project Explained 15:24 min

Now, how many chromosomes do you see? Is this a male or female? How many chromosomes do you see? IT’S A GIRL! KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end.

How many chromosomes? Which gender (sex)? It’s a BOY!

How scientists and doctors use karyotypes Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an individual’s DNA. Make a Karyotype

What do you get when you cross … instanta.blogspot.com i57.photobucket.com clouddragon.wordpress.com smh.com.au Genetic Engineering is… Inserting genes from one organism into a different organism. Genetic Engineering is… Inserting genes from one organism into a different organism.

How do we do mix genes?? Genetic engineering – find gene – cut DNA in both organisms – paste gene from one creature into other creature’s DNA – insert new chromosome into organism – organism copies new gene as if it were its own – organism reads gene as if it were its own – organism produces NEW protein: Remember: we all use the same genetic code!

Cutting DNA DNA “scissors” – enzymes that cut DNA – Restriction Enzymes used by bacteria to cut up DNA of attacking viruses EcoRI, HindIII, BamHI – cut DNA at specific sites enzymes look for specific base sequences ACTGA ATTCGGATCA TGACTTAAGCC TAGT

Restriction enzymes Cut DNA at specific sites - leave “sticky ends” GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site   Locate the section of gene we want. Restriction Enzyme DNA double strand.

Recombining DNA – Use the same enzymes for both pieces. – leave “sticky ends” on both – can glue DNA together at “sticky ends” GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA Cut the gene you want. GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA GTAAC CATTGCTTAAG Cut the chromosome you want to add the gene to. Recombinant DNA: DNA with foreign genes inserted. GAATTCACGCTT TGCGAA Use “sticky ends” to glue the two genes together. DNA Ligase joins the ends.

Why use Bacteria?? Recombined Gene produces needed protein in a different organism. Use Bacteria because it reproduces rapidly and is one-celled so easy to grow. How can bacteria read human DNA? 10 bacteria 20 minutes 40 bacteria 60 minutes 160 bacteria 100 minutes 5120 bacteria 200 minutes 1,310,720 bacteria 1,310,720 bacteria 6 hours

Bacterial DNA and plasmids Single circular chromosome – only one copy = haploid – no nucleus Other DNA = plasmids! bacterial chromosome plasmids

How can plasmids help us? A way to get genes into bacteria easily – insert new gene into plasmid – insert plasmid into bacteria = vector – bacteria now expresses new gene bacteria make new protein + transformed bacteria gene from other organism plasmid cut DNA recombinant plasmid vector glue DNA

Grow bacteria…make more grow bacteria harvest (purify) protein transformed bacteria plasmid gene from other organism + recombinant plasmid vector

Virtual Lab 12: Bacterial Transformation-Ampicillin Resistance

Other uses of Genetic Engineering: Genetically modified organisms (GMO) – enabling plants to produce new proteins Produce medications: insulin – Used by diabetics Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice – rice producing vitamin A

Genetic Engineering and Medicine Gene Therapy = using genetic engineering to combat disease. Hemophilia – patients suffer from a lack of Factor VIII.

Stem Cells…the key to our future? Stem Cells Red Blood Cells for accident victims and transfusions. Red Blood Cells for accident victims and transfusions. Muscle Cells to repair damaged or weak muscles. Muscle Cells to repair damaged or weak muscles. Heart Cells to repair damaged heart tissues. Heart Cells to repair damaged heart tissues.

Stem Cells

Biotechnology Gel Electrophoresis using-dna-evidence-to-solve-crimes-video.htm

Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… – we can cut up DNA from different people… or different organisms… and compare it – why? forensics medical diagnostics paternity evolutionary relationships and more…

Comparing cut up DNA Gel Electrophoresis How do we compare DNA fragments? – separate fragments by size How do we separate DNA fragments? – run it through a gelatin – gel electrophoresis How does a gel work?

Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field – DNA is negatively charged – when it’s in an electrical field it moves toward the positive side + – DNA        “swimming through Jello”

DNA moves in an electrical field… – so how does that help you compare DNA fragments? size of DNA fragment affects how far it travels – small pieces travel farther – large pieces travel slower & lag behind Gel electrophoresis + – DNA       

Running a gel 12 cut DNA with restriction enzymes fragments of DNA separate out based on size 3 Stain DNA – ethidium bromide binds to DNA – fluoresces under UV light

Virtual Lab 11 Restriction Enzyme Cleavage and Electrophoresis Lab: Electrophoresis

DNA Fingerprinting Why is each person’s DNA pattern different? – sections of “junk” DNA doesn’t code for proteins made up of repeated patterns – CAT, GCC, and others – each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships – + DNA  turtlesnakeratsquirrelfruitfly

Sequencing DNA: