AdrenoLeukoDystrophy Blong Yang Molecular Genetics Fall 2004 University of Wisconsin – Eau Claire Fall 2004.

Slides:



Advertisements
Similar presentations
Lecture 3 Strachan and Read Chapters 16 & 18
Advertisements

Lecture 45 Prof Duncan Shaw. Applications - finding genes Currently much interest in medical research, in finding the genes causing disease Sometimes.
Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,
Introduction to the ALD Newborn Screening Study to be performed at Frederick Memorial Hospital and three other Maryland Hospitals PART 1: BACKGROUND INFORMATION.
CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Section B: Sex Chromosomes 1.The.
What is Li-Fraumeni syndrome?
Chapter 14 Sec 1: Genes in Action
 What’s a “mutagen”?  What does a mutation do to DNA?  If a mutation affects a gene, then what might happen to the protein sequence?
Chapter 12: Patterns of Heredity & Human Genetics
Putting it all together: Finding the cystic fibrosis gene Cystic fibrosis (CF) is a genetic disorder that is relatively common in some ethnic groups A.
Fragile x syndrome By Jordon Nagel.
SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Chapter 14 – The Human Genome
Adrenoleukodystrophy By Nicolette Laird Lorenzo’s Oil.
Unit 4 Vocabulary Review. Nucleic Acids Organic molecules that serve as the blueprint for proteins and, through the action of proteins, for all cellular.
Genetic Engineering Intent of altering human genome
 Stem Cells. Understandings  Specialized tissues can develop by cell differentiation in multicellular organisms.  Differentiation involves the expression.
X-Linked Adrenoleukodystrophy (ALD)
Day one Adrenoleukodystrophy Called ALD a rare, inherited metabolic disorder the fatty covering (myelin sheath) on nerve fibers in the brain is lost,
ADDISON IN X-LINK ADRENOLEUKODYSTROPHY (X- ALD): Phenotype and genotype of 12 cases Nguyen Ngoc Khanh 1, Vu Chi Dung 1 , Shimozawa N 2. , Bui Phuong Thao.
1. Silent Mutations  Change in nucleotide has no effect on amino acid in protein  Occurs:  Introns  Wobble effect.
Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.
Niemann-Pick Disease Maggie W. George December 5, 2005.
DNA Chips Attach DNA to tiny spots on glass slides (i.e., chip). Hybridize fluorescently-labeled DNA probes to chip. Detect hybridization to different.
Objective 10: TSWBAT explain the chromosomal basis of sex and the unique inheritance patterns of sex-linked genes.
ABC half-transporter relative gene expression and metabolism of conjugated linoleic acid (CLA) in X- linked Adrenoleukodystrophy Petroni A 1. 1, Carissimi.
Human Genetic Diseases
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
Chapter 5 The Content of the Genome 5.1 Introduction genome – The complete set of sequences in the genetic material of an organism. –It includes the.
This is a work in progress! Subject to change in content and points offered for each section! Further discussion in class will clarify details! PROJECT.
Chapter 2 From Genes to Genomes. 2.1 Introduction We can think about mapping genes and genomes at several levels of resolution: A genetic (or linkage)
The Neurochemistry of Friedreich’s Ataxia By: Michelle Donnelly, Virginia Gamero, Vinson Li, and Pooja Maharajh PHM142 Fall 2015 Coordinator: Dr. Jeffrey.
Leukodystrophies Costello, D. J., A. F. Eichler, and F. S. Eichler. "Leukodystrophies: Classification, Diagnosis, and Treatment." Neurologist 15, no. 6.
Evolution at the Molecular Level. Outline Evolution of genomes Evolution of genomes Review of various types and effects of mutations Review of various.
4.3 Alterations In Chromosome Structure and Number
Welcome 2/10-11/16 1. Turn in Quick Lab and Dihybrid Cross 2. Other Mendelian Genetics and Disorders Notes 3. Practice Non-Mendelian Genetics.
Printing: Your printer might not print the same way our printers do, so make sure to try a couple of test prints. If things aren’t aligning quite right,
Chapter 12: Inheritance Patterns and Human Genetics.
Human Genetic Diseases & Pedigrees Pedigree analysis Pedigree analysis reveals Mendelian patterns in human inheritance – Data mapped on a family.
Hemophilia in Canis familiaris (dogs). General information MIM number: MIM number: MIA number: MIA number:
生物資料庫搜尋 ( 第八組 ) 連威森 王鼎 黃智楹 張鈞淵
GENETICS REVIEW QUESTIONS WITH ANSWERS. 1. The passing on of traits from parent to offspring is called…… ?? 2. The gamete that contains genes contributed.
ABO Blood Groups and Genetic Disorders
Figure 1. Partial genetic and physical map of chromosome 5q
Please pick up the notes, yeti sheet, and x-linked traits sheet.
A conditional knockout mouse model reveals endothelial cells as the principal and possibly exclusive source of plasma factor VIII by Scot A. Fahs, Matthew.
Volume 6, Issue 4, Pages (October 2000)
Peter John M.Phil, PhD Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences & Technology (NUST)
Mutation and Genetic Change
Vav‐1 gene‐targeting strategy.
GENETICS AND HEREDITY.
Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant
HUMAN GENETICS What can go wrong? Chromosome Gene Mutations Mutations.
Relationship between Genotype and Phenotype
Volume 10, Issue 8, Pages (April 2000)
Volume 65, Issue 6, Pages (June 2004)
Survival of Male Patients with Incontinentia Pigmenti Carrying a Lethal Mutation Can Be Explained by Somatic Mosaicism or Klinefelter Syndrome    The.
Mutations of the Ephrin-B1 Gene Cause Craniofrontonasal Syndrome
Ludovica Bruno, Hans Jörg Fehling, Harald von Boehmer  Immunity 
A Prematurely Expressed Igκ Transgene, but Not a VκJκ Gene Segment Targeted into the Igκ Locus, Can Rescue B Cell Development in λ5-Deficient Mice  Roberta.
Volume 58, Issue 2, Pages (August 2000)
Material for Quiz 5 from Chapter 8
Volume 57, Issue 3, Pages (March 2000)
Fig. 4. Targeted disruption of STK35 transcripts in mouse.
Early Onset of Severe Familial Amyotrophic Lateral Sclerosis with a SOD-1 Mutation: Potential Impact of CNTF as a Candidate Modifier Gene  Ralf Giess,
Contiguous Deletion of the X-Linked Adrenoleukodystrophy Gene (ABCD1) and DXS1357E: A Novel Neonatal Phenotype Similar to Peroxisomal Biogenesis Disorders 
Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse  Daniel L Burgess, Julie M Jones,
Volume 84, Issue 2, Pages (January 1996)
Presentation transcript:

AdrenoLeukoDystrophy Blong Yang Molecular Genetics Fall 2004 University of Wisconsin – Eau Claire Fall 2004

Adrenoleukodystrophy (ALD) What is Adrenoleukodystrophy: X-linked genetic disease that is a peroxisomal disorder with impaired beta- oxidation of saturated Very Long Chain Fatty Acids (VLCFA’s). X-linked genetic disease that is a peroxisomal disorder with impaired beta- oxidation of saturated Very Long Chain Fatty Acids (VLCFA’s). - First recognized in 1923 – Schindler’s Disease Siemerling and Creutzfeldt - First recognized in 1923 – Schindler’s Disease Siemerling and Creutzfeldt – Dr. Michael Blaw first coined the term Adrenoleukodystrophy – Dr. Michael Blaw first coined the term Adrenoleukodystrophy Adreno = Referring to adrenal glands Adreno = Referring to adrenal glands Leuko = Referring to white matter of the brain Leuko = Referring to white matter of the brain Dystrophy = Referring to imperfect growth/development Dystrophy = Referring to imperfect growth/development Caused by the X-ALD gene that encodes the ALD protein Caused by the X-ALD gene that encodes the ALD protein - Peroxisomal membrane protein - Peroxisomal membrane protein - Member of the ATP binding cassette transporter protein superfamily. - Member of the ATP binding cassette transporter protein superfamily. - Demonstrated using mouse model for X-linked ALD - Demonstrated using mouse model for X-linked ALD - Function that contributes to ALD is still unknown - Function that contributes to ALD is still unknown University of Wisconsin – Eau Claire Fall 2004 Lombard-Platet et al.Heinzer et al.

X-ALD Phenotypes Frequency of ALD in human population: Affects 1/20,000 males Affects 1/20,000 males There are 2 Major disease Phenotypes: 1. Childhood onset ALD Most severe form of ALD Most severe form of ALD Affects boys between the age of 4 – 6 years Affects boys between the age of 4 – 6 years Accounts for ~35% of ALD patients Accounts for ~35% of ALD patients Involves inflammatory demyelination of nerve cells Involves inflammatory demyelination of nerve cells Leads to a vegetable state Leads to a vegetable state Death within a few years Death within a few years University of Wisconsin – Eau Claire Fall 2004 Lombard-Platet et al.

Meet Alex………. Born May 1993 and appears as a normal healthy boy. Born May 1993 and appears as a normal healthy boy. Age 3, difficulties Potty training. Age 3, difficulties Potty training. Age 7, has difficulties at school, fighting, constantly getting lost, difficulty learning material and keeping attention in class. Age 7, has difficulties at school, fighting, constantly getting lost, difficulty learning material and keeping attention in class. MRI diagnose Alex with ALD MRI diagnose Alex with ALD Age 8, Alex can no longer walk. Loses sight, muscle coordination, ability to speak and swallow. Age 8, Alex can no longer walk. Loses sight, muscle coordination, ability to speak and swallow. Currently, Alex is still alive and undergoing muscle therapy and on muscle relaxants, baclofen and Clonidine. Currently, Alex is still alive and undergoing muscle therapy and on muscle relaxants, baclofen and Clonidine. University of Wisconsin – Eau Claire Fall 2004

X-ALD Phenotypes 2. Adult onset ALD or Adrenomyeloneuropathy Occurrence at a mean age of /- 8.7 years. Occurrence at a mean age of /- 8.7 years. Most common, accounting for ~ 65% of ALD patients Most common, accounting for ~ 65% of ALD patients Progresses slowly Progresses slowly Adrenal impairment Adrenal impairment Involves mainly long tracts of the spinal cord and peripheral nerves Involves mainly long tracts of the spinal cord and peripheral nerves No involvement of the Brain No involvement of the Brain Little or No inflammation Little or No inflammation Learning disabilities, perceptual problems, attention deficit disorder, short and long-term memory loss, impaired vision, coordination or gait, and various personality and behavioral changes. Learning disabilities, perceptual problems, attention deficit disorder, short and long-term memory loss, impaired vision, coordination or gait, and various personality and behavioral changes. 3. Addison Disease Impaired Adrenal Function Impaired Adrenal Function Adrenocortical Insufficiency with no detectable neurological involvement Adrenocortical Insufficiency with no detectable neurological involvement “Bronzing” of the skin “Bronzing” of the skin University of Wisconsin – Eau Claire Fall 2004 Lombard-Platet et al.

Location and Cloning of X-ALD Gene First cloned in 1993 First cloned in 1993 Cloned by Mosser et al. Cloned by Mosser et al. Method: Positional Cloning Method: Positional Cloning Approach: Approach: –Hypothesize that the location of X-ALD gene must be Xq28, where the red/green color pigment gene (R/GPG) resides. On the basis of the high incidence of colour vision anomalies in AMN and ALD patients, the ALD and R/GPG must be close. –Identify a patient (Patient O) with blue-monochromatic colour vision with a rearrangement located 5’ of Re-Colour pigment (RCP) gene, including two deletions separated by a large (>100 kb) inversion. –Only the RPC gene is found on the first deletion (88 kb). This deletion was not found in 81 other ALD patients, therefore they postulated that the inverted repeat or the second deletion were candidate loci for the ALD gene. University of Wisconsin – Eau Claire Fall 2004 Mosser et al.

Location and Cloning of X-ALD Gene BP4-BP2 and BP3- BP1 shows breakpoint 4 and 2 and of points 3 and 1. BP4-BP2 and BP3- BP1 shows breakpoint 4 and 2 and of points 3 and 1. Dotted line represents the breakpoint junctions cloned. Dotted line represents the breakpoint junctions cloned. Use a probe 4 kb proximal to Fr15 deleted in Patient O (15) to obtain clones from a Xq28 cosmid library. Use a probe 4 kb proximal to Fr15 deleted in Patient O (15) to obtain clones from a Xq28 cosmid library. 3 overlapping clones were obtained spanning 90 kb (cosQc11H12, cosQc8F3 and cosQc14A11) 3 overlapping clones were obtained spanning 90 kb (cosQc11H12, cosQc8F3 and cosQc14A11) In parallel, an Xba1 junction fragment (X-8) was cloned corresponding to BP4- BP2 in patient O. In parallel, an Xba1 junction fragment (X-8) was cloned corresponding to BP4- BP2 in patient O. University of Wisconsin – Eau Claire Fall 2004 A Map of the ALD gene Mosser et al.

Location and Cloning of X-ALD Gene Restriction map of X-8 showed a 1.8 kb Xbal- EcoR1 (X2) fragment. It contained a 1.6 kb segment on the BP4 side and is within the Fr15 contig. Restriction map of X-8 showed a 1.8 kb Xbal- EcoR1 (X2) fragment. It contained a 1.6 kb segment on the BP4 side and is within the Fr15 contig. Use Taq1 to generate probes from digestion of cosQc11h12. Use Taq1 to generate probes from digestion of cosQc11h12. Probes generated are Ta25 (2.1 kb), Ta4 (3.6 kb), Ta1 (1.0 kb), Ta18 (0.85 kb), Ta13a (935 bp), Ta13b (252 bp). Probes generated are Ta25 (2.1 kb), Ta4 (3.6 kb), Ta1 (1.0 kb), Ta18 (0.85 kb), Ta13a (935 bp), Ta13b (252 bp). Probes detected deletions in 5 patients. Patient O, B, R, L and Family Ma. Probes detected deletions in 5 patients. Patient O, B, R, L and Family Ma. University of Wisconsin – Eau Claire Fall 2004 Generating Probes Mosser et al.

Location and Cloning of X-ALD Gene Figure d shows segregation of an abnormal junction fragment detected by probe X2 in family. Figure d shows segregation of an abnormal junction fragment detected by probe X2 in family. Here, you can see a 14.4 abnormal fragment was detected in an affected male as well as heterozygous females. Here, you can see a 14.4 abnormal fragment was detected in an affected male as well as heterozygous females. Figure e shows 3 brothers whose DNA is digested with HindIII and probed with X2. The affected brother, filled square shows an abnormal 22 kb fragment. The brother affected shows the same 22 kb fragment. Unaffected brother doesn’t show 22 kb fragment. Figure e shows 3 brothers whose DNA is digested with HindIII and probed with X2. The affected brother, filled square shows an abnormal 22 kb fragment. The brother affected shows the same 22 kb fragment. Unaffected brother doesn’t show 22 kb fragment. Southern Blot University of Wisconsin – Eau Claire Fall 2004 Mosser et al.

Sequencing the ALD gene Use probes TA25, TA18, TA13a and TA13b to probe for transcripts in several tissues. Use probes TA25, TA18, TA13a and TA13b to probe for transcripts in several tissues. Discovered a 4.2 kb transcript. Discovered a 4.2 kb transcript. The sequences for these probes determined (Using a computer program based on a multiple sensor-neural network approach.) The sequences for these probes determined (Using a computer program based on a multiple sensor-neural network approach.) Sequencing revealed a large 700 bp putative protein coding region for TA25 and between 300 – 400 bp regions for TA18, TA13b and TA13a Sequencing revealed a large 700 bp putative protein coding region for TA25 and between 300 – 400 bp regions for TA18, TA13b and TA13a Discovered that the deduced amino-acid sequence from these sequences showed significant sequence identity with collinearly positioned regions of human and rat 70 K peroxisomal membrane protein (PMP). Discovered that the deduced amino-acid sequence from these sequences showed significant sequence identity with collinearly positioned regions of human and rat 70 K peroxisomal membrane protein (PMP). University of Wisconsin – Eau Claire Fall 2004 Mosser et al.

Using Nested - P.C.R reactions with primers from putative exons produced two fragments. Ex13 and Ex3. These fragments where then used to screen a random-primed HeLa cell cDNA library to obtain 6 independent overlapping clones, Producing a 2,751 bp sequence encoding a 745 aa protein.

Protein Homology Alignment of the c-terminal amino-acid sequence of ALD Protein with human and rat 70 K PMP and other members of The ATP-binding protein family. Identical are in black, Conservative substitutions are in gray. The two ATP binding Domains are underlined, the segment highly conserved in ABC proteins are indicated by asterisks. University of Wisconsin – Eau Claire Fall 2004

Conclusions drawn by J. Mosser et al. The putative location of the ALD gene is in the distal part of Xq28. The putative location of the ALD gene is in the distal part of Xq28. The ALD gene does not code for VLCDF – CoA synthetase which was once considered to be the cause of ALD. The ALD gene does not code for VLCDF – CoA synthetase which was once considered to be the cause of ALD. The ALD gene codes for a protein that is almost identical to human and rat 70 K Peroxisome membrane protein. The ALD gene codes for a protein that is almost identical to human and rat 70 K Peroxisome membrane protein. The ALD protein is a member of the ATP – Binding Cassette (ABC) transporter protein, which are involved in the transport of proteins, amino acids, inorganic ions and peptides. The ALD protein is a member of the ATP – Binding Cassette (ABC) transporter protein, which are involved in the transport of proteins, amino acids, inorganic ions and peptides. The ALD must either nonfunctional in transport of VLCFA or it might be inhibited from activating VLCFA – CoA synthetase. The ALD must either nonfunctional in transport of VLCFA or it might be inhibited from activating VLCFA – CoA synthetase. It is still unresolved why the brain and adrenal glands are so sensitive to the buildup of VLCFA. It is still unresolved why the brain and adrenal glands are so sensitive to the buildup of VLCFA. University of Wisconsin – Eau Claire Fall 2004 Mosser et al. Heinzer et al.

Map of the ALD gene The X-ALD gene is approximately 20 kb long and consists of 10 exons. Mutations to the ALD gene that have been discovered can be found at To date, there are 703 mutations in theirhttp:// Database.

Mouse model for X-linked ALD NO!!!YES!!! - J.F. Lu et al. In Use mouse model to show that the ALD gene leads to the accumulation of VLCFA. -Method – Disruption of the ALD gene with Neo-R gene. University of Wisconsin – Eau Claire Fall 2004

Disruption of the X-ALD mouse gene Depiction of X-ALD gene exons 1-4. Gene targeting of the X-ALD locus used a replacement- Type vector covering between Dashed lines. Homologous recombination Causes disruption in the X-ALD Gene in ES cells. Grown on selective medium containing Gangcyclovir. Select surviving cells. Use XbaI to digest and run On southern blot and Probe For sequences. Wildtype ES has 7 kb sequence, Mutant has 8 kb sequence. University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

Disruption of the X-ALD mouse gene Using neo-r cassette-specific primers (e or b) in combination with external primers (a or f) ES cells 1-3 generated a 4 kb PCR product but no results for normal ES cell. Using internal primers (d or c) in combination with external (a or f), wildtype produced a 3 kb PCR product while mutant ES 1-3 cells produced the 4 kb (included the neo-r gene). University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

Production of Chimeras and transmittance of X-ALD gene The targeted ES cells are injected into blastocysts derived from C57bl/6 strain and the blastocysts were transferred into pseudo-pregnant CD-1 female mice to generate chimeras. The targeted ES cells are injected into blastocysts derived from C57bl/6 strain and the blastocysts were transferred into pseudo-pregnant CD-1 female mice to generate chimeras. Female gave birth to 9 chimeras (6 males, 3 females) Female gave birth to 9 chimeras (6 males, 3 females) Males are crossed to C57BL/6 to transmit X-ALD- allele to progeny giving rise to heterozygous female carrier mice. Males are crossed to C57BL/6 to transmit X-ALD- allele to progeny giving rise to heterozygous female carrier mice. Heterozygous female mice crossed with either 129/Sv strain or C57bl/6 strain to generate hemizygous male mice (X-ALD-/ 0 ). Heterozygous female mice crossed with either 129/Sv strain or C57bl/6 strain to generate hemizygous male mice (X-ALD-/ 0 ). Among the progeny: Among the progeny: Normal sex ratio (Male:Female = 110:102) indicating hemizygotes are not embryonic lethal. Normal sex ratio (Male:Female = 110:102) indicating hemizygotes are not embryonic lethal. Out of 110 male mice, 54 were X-ALD-/ 0. Out of 110 male mice, 54 were X-ALD-/ 0. University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

There is a great difference in the amount of total VLCFAs in normal and X-ALD mice and humans as well, especially when the FAs contain more than 26 carbon units. University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

Histological Analysis Performed at 3 months. Slide A shows healthy normal adrenocortical cells. X-ALD-/ 0 Slide B shows an X-ALD-/ 0 mouse adrenocortical cells with clear lipid clefts (indicated by arrows). Slide C shows the lipid cleft admixed with spicular lamellar material at high magnification. (x 15,000) University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

Conclusion of Mouse Study The X-ALD gene leads to the accumulation of VLCFAs in various tissues including the brain, kidneys, pancreas, liver and heart. But the level of accumulation of each tissue varies. The X-ALD gene leads to the accumulation of VLCFAs in various tissues including the brain, kidneys, pancreas, liver and heart. But the level of accumulation of each tissue varies. The oldest mice at the end of the study were 6 months old and did not show any symptoms of adrenal insufficiency or nervous system dysfunction. It is yet too early to conclude that the X-ALD will not have any neurological involvement equivalent to that of human X- ALD. The oldest mice at the end of the study were 6 months old and did not show any symptoms of adrenal insufficiency or nervous system dysfunction. It is yet too early to conclude that the X-ALD will not have any neurological involvement equivalent to that of human X- ALD. Biochemically, the X-ALD mouse model represents a valid animal model for X-ALD. Most importantly, X-ALD in both mouse and humans result in elevated tissue levels of saturated VLCFAs, with the most severe abnormalities localized to the brain and adrenal gland. Biochemically, the X-ALD mouse model represents a valid animal model for X-ALD. Most importantly, X-ALD in both mouse and humans result in elevated tissue levels of saturated VLCFAs, with the most severe abnormalities localized to the brain and adrenal gland. University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

Diagnosis and Treatment of ALD Diagnosis: Diagnosis: –Simple blood tests can be done to analyze the levels of VLCFAs in males. This test is not very accurate for female carries. –Genetic testing is available through a DNA-based blood test. This test is accurate in testing for carriers. The entire testing protocol is available through the United Leukodystrophy Foundation (ULF). Treatment: Treatment: –There is no definitive treatment to ALD –Lorenzo’s Oil diet (not FDA approved) –Bone Marrow Transplant –Gene therapy has been developed in animal models, but is currently not available to human patients. University of Wisconsin – Eau Claire Fall 2004 J.F. Lu et al.

One more thing…….. Reviews: “Ebert and Roeper” - Two thumbs up!- University of Wisconsin – Eau Claire Fall 2004

References: Heinzer, A.K., Kemp, Stephan., Lu, J.F., Watkins, P.A., Smith, K.D. “Mouse Very Long- chain Acyl-CoA Synthetase in X-Linked Adrenoleukodystrophy.” J. Biol. Chem. Vol 277, Issue 32, (2002) Heinzer, A.K., Kemp, Stephan., Lu, J.F., Watkins, P.A., Smith, K.D. “Mouse Very Long- chain Acyl-CoA Synthetase in X-Linked Adrenoleukodystrophy.” J. Biol. Chem. Vol 277, Issue 32, (2002) Heinzer, A.K., Watkins, P.A., Lu, J.F., Kemp, Stephan., Moser, A.B., Li, Y.Y., Mihalik, S., Powers, J.M., Smith, K.D. “A Very Long-chain Acyl-CoA Synthetase Deficient Mouse and Its Relevance to X-linked Adrenoleukodystrophy.” Human Molecular Genetics Vol. 12 No. 10, (2003) Heinzer, A.K., Watkins, P.A., Lu, J.F., Kemp, Stephan., Moser, A.B., Li, Y.Y., Mihalik, S., Powers, J.M., Smith, K.D. “A Very Long-chain Acyl-CoA Synthetase Deficient Mouse and Its Relevance to X-linked Adrenoleukodystrophy.” Human Molecular Genetics Vol. 12 No. 10, (2003) Lombard-Platet, Gael., Savary, Stephane., Sarde, C.O., Mandel, J.L., Chimini, G. “A Close Relative of the Adrenoleukodystrophy Gene Codes for a Peroxisomal Protein With a Specific Expression Pattern.” Proc. Natl. Acad. Sci. USA 94, (1996) Lombard-Platet, Gael., Savary, Stephane., Sarde, C.O., Mandel, J.L., Chimini, G. “A Close Relative of the Adrenoleukodystrophy Gene Codes for a Peroxisomal Protein With a Specific Expression Pattern.” Proc. Natl. Acad. Sci. USA 94, (1996) Lu, J.F., Lawler, A.M., Watkins, P.A., Powers, J.M., Moser, A.B., Moser, H.W., Smith, K.D. “A Mouse Model for X-linked Adrenoleukodystrophy.” Proc. Natl. Acad. Sci. USA 94, (1997) Lu, J.F., Lawler, A.M., Watkins, P.A., Powers, J.M., Moser, A.B., Moser, H.W., Smith, K.D. “A Mouse Model for X-linked Adrenoleukodystrophy.” Proc. Natl. Acad. Sci. USA 94, (1997) Mosser, J., Douar. A., Sarde, O., Petra, K., Feils, R., Moser, H., Poustka, A.M., Mandel, J.L., Aubourg, P. “Putative X-linked Adrenoleukodystrophy Gene Shares With Unexpected homology with ABC Transporters.” Nature 361, (1993) Mosser, J., Douar. A., Sarde, O., Petra, K., Feils, R., Moser, H., Poustka, A.M., Mandel, J.L., Aubourg, P. “Putative X-linked Adrenoleukodystrophy Gene Shares With Unexpected homology with ABC Transporters.” Nature 361, (1993) University of Wisconsin – Eau Claire Fall 2004