What causes LCA2 blindness? light RPE65 trans-retinal change [Na+] send signal on optic nerve cis-retinal

LCA2 blindness: light change [Na+] send signal on optic nerve trans-retinal change [Na+] send signal on optic nerve cis-retinal trans-retinal

Is LCA2 allele dominant or recessive? RPE65 gene normal allele LCA2 chromosome 1 RPE65 transcription translation no functional protein

What is the probability of another LCA2 child? What are the genotypes? What is the probability of another LCA2 child? Rr rr R = normal RPE65 r = LCA2 1 in 4 chance next child will be blind by age 20

How could we prevent or cure this disease? Rr rr R = normal RPE65 r = LCA2 1 in 4 chance next child will be blind by age 20 What would we need to have in order to do gene therapy?

Where can we find the RPE65 gene? human DNA RPE65 gene Joe cell OK, but now what?

Gene cloning Isolate a specific gene of interest Insert into a plasmid human RPE65 gene Isolate a specific gene of interest Insert into a plasmid Transfer to bacteria Grow bacteria to get many copies Express the protein product Why? Sequence the gene Study the enzyme Understand regulation Genetic screening Gene therapy …etc. plasmid recombinant DNA human RPE65 enzyme E. coli

Steps in gene cloning Isolate DNA including YFG human RPE65 gene Isolate DNA including YFG Join to plasmid vector (ligation) Introduce into host (transformation) Find correct clone Express the protein product ligation plasmid recombinant DNA transformation human RPE65 enzyme E. coli

1. Isolate DNA including YFG Extract from cells Cut into manageable fragments RPE65 gene RPE65 gene human DNA

Restriction digest GAATTC CTTAAG GAATTC CTTAAG GAATTC CTTAAG human DNA cloning vector (plasmid)

2. Join to plasmid vector (ligation) restriction fragment AATTC G CTTAA “sticky” ends cloning vector (plasmid)

2. Join to plasmid vector (ligation) DNA ligase GAATTC CTTAAG GAATTC CTTAAG recombinant plasmid what’s missing? what enzyme should we use?

2. Join to plasmid vector (ligation) + human DNA fragments plasmid library

3. Introduce into host (transformation) + recombinant DNA E. coli CaCl2 or electric shock recombinant E. coli

3. Introduce into host (transformation)

3. Introduce into host (transformation) Select cells that have plasmid by antibiotic resistance agar plate with ampicillin

4. Find the correct clone How do we know which of all these colonies came from a cell that took up a plasmid carrying RPE65?

This won’t work. Why not? 4. Find the correct clone Enzyme assay for RPE65 trans- retinal HPLC This won’t work. Why not? proteins from lysed bacteria

Why my clones can’t make RPE65 protein: RPE65 gene has introns; bacteria can’t splice Expression signals: Transcription: bacteria need -10 and -35 human gene has TATA, enhancers, etc. Translation: bacteria need Shine-Dalgarno human gene won’t have it ? ? ATG TAG enhancers TATA

cDNA cloning: DNA copy of RNA Spliced mRNA → coding sequence with no introns DNA nucleus mRNA cytoplasm mature RNA AAAAAAAAAAAAAAA reverse transcriptase Why does it have to be DNA? DNA

cDNA cloning Purify mRNA: from what kind of cells? from where in the cell? AAAAAAAAAA mRNA

cDNA cloning Add reverse transcriptase to make cDNA AAAAAAAAAA TTTTTTT

cDNA cloning Add reverse transcriptase to make cDNA

cDNA cloning Ligate to a plasmid vector +

cDNA cloning Transform into E. coli Find correct clone cDNA library Now could we express the protein product??

Expression vector Plasmid with transcription and translation signals -10 -10 -35 EcoRI S-D RPE65 cDNA -35 EcoRI S-D expression vector

4. Find the correct clone Enzyme assay for RPE65 HPLC trans- retinal proteins from lysed bacteria

Cloned gene is ready for use! purify plasmid DNA sequencing express protein etc.

Cloning by PCR Polymerase chain reaction If DNA sequence is known, amplify specific gene directly PCR RPE65 gene human DNA

Cloning by PCR Human DNA RPE65-specific 20-nt primers Taq DNA polymerase dNTPs part of RPE65 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG 3′ TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCTCC heat 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG TTTGACACCT 5′ primer TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAAC heat 5′ CCAGGTTGAG TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCT 5′ primer CATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGA

Cloning by PCR

+ Cloning by PCR Once amplified, ligate and transform as before plasmid vector amplified copies of RPE65 gene

Genetic engineering

Genetic engineering Modified microorganisms: Insulin, growth hormone, clotting factors, EPO… HPV vaccine Ethanol from cellulose Oil-eating bacteria Modified plants and animals BT corn Roundup-ready soybeans Golden rice Modified humans Gene therapy

Unlimited possibilities Recombinant DNA technology: Unlimited possibilities Many questions