Genetic Engineering
Allows scientists to manipulate the DNA (genome) of living things. Selective Breeding (original genetic engineering) Crossing organisms w/desired traits Selecting traits in animals – used inbreeding Domestic animals; dogs, cows, pigs, goats, sheep, etc. Growing seeds from plants that had traits prefered Example: the brassica family original plant:
Any guesses?
Mutations are the ultimate source of biodiversity! When mutations are isolated, they can then be introduced into populations. Now that we can analyze & manipulate DNA this can be done on the molecular level! This can be done between different species! Example: can use bacteria and viruses to insert DNA
Benefits: Recombinant DNA has applications in agriculture, industry, medicine & forensics. Draw backs: There are ethical, legal, safety and social issues surrounding genetic engineering.
They use the smallest scissors! To cut DNA into smaller pieces Called Restriction Enzymes It’s like using the “search” function. Copy the following DNA sequence in your BFF. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA Look carefully to find this specific series: GTTAAC When you find it, divide the sequence in half between the T and A. How many occurrences? How many fragments of DNA?