Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology.

Slides:



Advertisements
Similar presentations
DNA Technology & Genomics
Advertisements

What do you notice about these phrases?
Restriction Enzymes. Restriction Endonucleases Also called restriction enzymes 1962: “molecular scissors” discovered in in bacteria E. coli bacteria have.
V) BIOTECHNOLOGY.
Restriction Enzymes and Gel Electrophoresis
Lecture ONE: Foundation Course Genetics Tools of Human Molecular Genetics I.
Genetic engineering ­ Genetic engineering: manipulating DNA or organisms to perform practical tasks or provide useful products We’re going to look at the.
©2000 Timothy G. Standish Restriction Enzyme Digestion Timothy G. Standish, Ph. D.
AP Biology Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need.
Biotechnology Techniques How to make Recombinant DNA Gel Electrophoresis PCR Summarize: What is this technique? Draw and label a diagram to show this technique.
Quickie Intro to DNA Technologies
DNA Technology & Genomics
Chapter 20~ DNA Technology & Genomics
DNA Technology n Now it gets real….. O.J. Simpson capital murder case,1/95-9/95 Odds of blood on socks in bedroom not being N. Brown-Simpson’s: 8.5 billion.
Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:
MCC BP Based on work by K. Foglia What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man,
AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was.
Chapter 20 Notes: DNA Technology. Understanding & Manipulating Genomes 1995: sequencing of the first complete genome (bacteria) 2003: sequencing of the.
DNA Technology & Genomics
Biotechnology.
1 Genetics Faculty of Agriculture Instructor: Dr. Jihad Abdallah Topic 13:Recombinant DNA Technology.
AP Biology Chapter 20. Biotechnology: DNA Technology & Genomics.
Chapter 20 Notes: DNA Technology. Understanding & Manipulating Genomes 1995: sequencing of the first complete genome (bacteria) 2003: sequencing of the.
Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.
Manipulating DNA.
Part 1: Basic Biotechnology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA.
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert.
AP Biology Biotechnology Slide show by Kim Foglia (modified) Blue edged slides are Kim’s.
Restriction Enzymes. Restriction Endonucleases Also called restriction enzymes “molecular scissors” discovered in in bacteria Restriction enzymes is an.
Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.
Genetic Engineering Chapter 13 Recombinant DNA Transformation Biotechnology Gel Electrophoresis PCR.
Review from last week. The Making of a Plasmid Plasmid: - a small circular piece of extra-chromosomal bacterial DNA, able to replicate - bacteria exchange.
© SSER Ltd.. Gene Technology or Recombinant DNA Technology is about the manipulation of genes Recombinant DNA Technology involves the isolation of DNA.
Recombinant DNA and Genetic Engineering
Introduction to Biotechnology ~manipulating and analyzing DNA.
PHARMACOBIOTECHNOLOGY.  Recombinant DNA (rDNA) is constructed outside the living cell using enzymes called “restriction enzymes” to cut DNA at specific.
Chapter 20 DNA Technology & Genomics. Genetic engineering Manipulation of genetic material for practical purposes has begun industrial revolution in biotechnology.
Chapter 20: Terms to Know Genetic engineering Biotechnology
GENETIC ENGINEERING CHAPTER 20
6.1 - Biotechnological Tools & Techniques
Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.
BIOTECHNOLOGY DNA is now being easily manipulated. Molecular biologists analyze and alter genes and their respective proteins. Recombinant DNA is DNA from.
Biotechnological Tools and Techniques. 1. Restriction Endonuclease (enzymes) Molecular scissors. Recognizes specific sequence (recognition site) on DNA.
Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.
Chapter 20: Part 1 DNA Cloning and Plasmids
SBI 4U December 2012 Manipulating & Cloning DNA. Introduction Insulin, diabetes and genetic engineering Genetic engineering: the intentional production.
AP Biology Plasmids  Small supplemental circles of DNA  ,000 base pairs  self-replicating  carry extra genes  2-30 genes  genes for antibiotic.
Recombinant DNA recombinant DNA – techniques in which genes from two different sources - often different species - are combined in vitro into the same.
AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was.
What do you notice about these phrases?
Bacterial Transformation
Introduction to Biotechnology
What do you notice about these phrases?
The DNA Toolbox.
Biotechnology
DNA Technology & Genomics
DNA Technology Now it gets real…..
Biotechnology: Part 1 DNA Cloning, Restriction Enzymes and Plasmids
DNA Technology & Genomics
Chapter 20~ DNA Technology & Genomics
What do you notice about these phrases?
Chapter 20~ DNA Technology & Genomics
Chapter 13~ DNA Technology & Genomics
Biotechnology.
TOOLS OF BIOTECHNOLOGY
Bacteria Bacteria review one-celled prokaryotes reproduce by mitosis
Biotechnology Gel Electrophoresis
Lecture #9 Date _____ Chapter 20~ DNA Technology & Genomics.
Biotechnology
Biotechnological Tools and Techniques
Presentation transcript:

Happy Monday! Checking off: Notes on Ch 20.1, 20.2 With your group, discuss what you know about these: – Methylation and Acetylation – Genetic Engineering/Biotechnology – Restriction enzymes – Gel Electrophoresis

Methylation and Acetylation

The BIG Questions… How can we use our knowledge of DNA to: – diagnose disease or defect? – cure disease or defect? – change/improve organisms? What are the techniques & applications of biotechnology? – direct manipulation of genes for practical purposes

Biotechnology Today Genetic Engineering – manipulation of DNA – if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with – this “unit” is a survey of those tools… Our tool kit…

Bioengineering Tool kit Basic Tools – restriction enzymes – ligase – plasmids / cloning – DNA libraries / probes Advanced Tools – PCR – DNA sequencing – gel electrophoresis – Southern blotting – microarrays

Cut, Paste, Copy, Find… Word processing metaphor… – cut restriction enzymes – paste ligase – copy plasmids – Bacteria transformation PCR – find Southern blotting / probes

Cut DNA Restriction enzymes – restriction endonucleases – discovered in 1960s – evolved in bacteria to cut up foreign DNA (“restriction”) protection against viruses & other bacteria

What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw?

Restriction Enzymes Also known as restriction endonucleases, are enzymes that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The enzyme "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides.

Restriction Enzymes, c’td Action of enzyme – cut DNA at specific sequences restriction site – symmetrical “palindrome” – produces protruding ends sticky ends Many different enzymes – named after organism they are found in EcoR I, Hind III, BamH I, Sma I Madam I’m Adam CTGAATTCCG GACTTAAGGC CTG|AATTCCG GACTTAA|GGC  

AATTC GAATTC G G G G G CTTAAG GAATTC CTTAAG CTTAA CTTAAG DNA ligase joins the strands. DNA Sticky ends (complementary single-stranded DNA tails) Recombinant DNA molecule AATTC G G CTTAA How restriction enzymes are used Restriction enzyme cuts the DNA Add DNA from another source cut with same restriction enzyme

Paste DNA Sticky ends allow: – H bonds between complementary bases to anneal Ligase – enzyme “seals” strands bonds sugar- phosphate bonds covalent bond of DNA backbone

Then what? DNA, cut at restriction sites, will be different lengths and will contain genes within those lengths. To analyze, mix with solutions that will allow them to travel through a medium based on size, shape, and charge. Gel electrophoresis is a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and charge.

Homework Complete Pre-lab activity for Transformation Lab – Get to Know Bacterial Transformation – Flowchart all steps