An Introduction to. What is XNA?  “A set of tools with a managed runtime environment provided my Microsoft that facilitates computer game development.

Slides:



Advertisements
Similar presentations
Välkommen till Sommarkollo Introduce XNA Game Studio Express Make A Game!
Advertisements

PRESENTS…. Team Flipped Normals Sriram Ganesh – Programmer. Sujan Sundareswaran – Designer/Artist. We are students of Image College of Arts, Animation.
Dan Waters, Academic Relations Manager, Microsoft.
Technical Workshops | Esri International User Conference San Diego, California Building Applications with ArcGIS Runtime SDK for Windows Phone Rex Hansen.
Survey of Graphics and Games. Outline Overview of computer graphics – Coursework – Research Programming using game engines Computer game and animation.
Course Overview Introduction to XNA Game Studio Express Game Design Experience Prof. Jim Whitehead January 7, 2008.
Havok Physics May Ang CS 164. Overview Developed by Havok Also make several other development tools Version 1.0 SDK released in 2000 Currently on Version.
Web Design Software & Curriculum Web Design A Door to your Students’ World ISTE 2010, Denver, Colorado Pat Phillips, K-12 Curriculum Programs Microsoft.
Microsoft Office 2013 ®® Appendix A Introduction to Cloud Computing.
There has never been a better time to build a game that targets PC, tablets, phone and Xbox!
Alfred Thompson Microsoft Corporation Academic Relations Team.
Using Microsoft Applications At Home WAH vs. HUP Information Technology TechTalk – January 2010.
A Games Class Using XNA Game Studio Express Art Gittleman California State University Long Beach
Developing games and applications for Xbox 360 using XNA* *XNA is XNA’s Not Acronymed An Introduction by Peter Messenger Senior Developer at QMASTOR Newcastle.
Independent Game Development William Monks. What is an “Indie” Game??? An indie game is a game made without the financial support of a video game publisher.
I can haz gamez?. Bret Stateham Microsoft Developer Evangelist Blog:
Lab 8 – C# Programming Adding two numbers CSCI 6303 – Principles of I.T. Dr. Abraham Fall 2012.
11 Games and Content Session 4.1. Session Overview  Show how games are made up of program code and content  Find out about the content management system.
Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.
1 Wednesday, August 6, 2008 ASYNCHRONY SOLUTIONS Making cross-platform Windows/Xbox 360 games in XNA.
Windows XP End of Life Microsoft support for Windows XP SP3 and Office 2003 ends April 8, 2014.
 Frank Savage Architect Microsoft Corporation.
CSC 494/594 C# and ASP.NET Programming. C# 2012 C# Object-oriented language with syntax that is similar to Java.
Las Vegas XNA Users Group. October 2007 MEETING! Presented by Charley Jones A+, MOUS, MCP, MCSA, MCSE, MCDBA, MCAD, MCT, PMP, ITIL MCTS: SQL Server 2005,
Windows Windows Phone Azure … and WakeUpAndCode.com.
Tim Madden ODG/XSD.  Graphics Processing Unit  Graphics card on your PC.  “Hardware accelerated graphics”  Video game industry is main driver.  More.
GreatFriends vTalks Seminar #10. XNA Game Programming Supote Phunsakul (ball)
Chapter 11 An Introduction to Visual Basic 2008 Why Windows and Why Visual Basic How You Develop a Visual Basic Application The Different Versions of Visual.
C# Game Development with XNA Philip Degarmo. Introduction What is XNA? –Microsoft’s replacement for “Managed DirectX” –“XNA” = “XNA Game Studio” – de.
11 Using the Keyboard Session Session Overview  Introduce the keyboard device  Show how keys on a keyboard can be represented by enumerated types.
Chapter 11 An Introduction to Visual Basic 2005 Why Windows and Why Visual Basic How You Develop a Visual Basic Application The Different Versions of Visual.
Development and Debugging Tools for Windows Phone 7 Series Cullen Waters Software Development Engineer II Advanced Technology Group, Microsoft Corporation.
Tim Madden ODG/XSD.  Graphics Processing Unit  Graphics card on your PC.  “Hardware accelerated graphics”  Video game industry is main driver.  More.
Windows Windows Phone Azure … and WakeUpAndCode.com.
Bernard “Berno” Oh Academic Audience Marketing t-berno [at] microsoft [dot] com 9 Jan 2007 Create Your Own Windows-Xbox.
Funativity CS 426 Fall Outline Team members Tools Overview Programming Art Game Inspiration Game Description Demo.
May06-11: ISEAGE Attack Tool Repository and Player Jeremy Brotherton, Timothy Hilby, Brett Mastbergen, Jasen Stoeker.
Bridges to the Magickal Faerie Land of Windows 10 Hannes Nel M263.
CSE3AGT - Audio Paul Taylor Sound Technologies XACT (Cross Platform Audio Creation Tool) – XACT is the audio production tool for Xbox development,
CS 490 GRAPHICS COMPUTER Lecture 1: Introduction Computer Science Department 1.
By : Andrew Volz. The reason I want to be a video game designer is because I love to play video games and I’ve always wanted to make my own game.
11 Computers, C#, XNA, and You Session 1.1. Session Overview  Find out what computers are all about ...and what makes a great programmer  Discover.
Ibraheem Osama Mohamed Mobile Developer-Rashdan IT.
Invitaion From Choi Island: Online Board Game Using C 멘토 : 권상구 멘토님 (KOG) 담당교수 : 고석주 교수님 팀원 : 박용남 ( ) 최재진 ( ) 김민규 ( )
Rong Lu Senior Program Manager Building Unity games in Visual Studio.
Getting Visual Studio You can download Visual Studio 2015 Community Edition for free from the Microsoft web site.
Cumulative Updates and Future Versions How New Releases Will Work in the Future Microsoft Dynamics NAV.
Welcome to ACM Gamebuilders!
Lecture 1 - Introduction
Porting your Unity Game to the Windows Store Jump Start
Computer Software: Programming
專題課程介紹 快速視覺化 多媒體/影像處理程式發展
Getting Started with Visual Studio Tools for Tizen
Creating your first C++ program using Visual Studio 2010
MonoGame and Windows 8.
Break out of the box with Python
Introduction to R.
From Navision To Microsoft
Developing Games for Windows Phone 7 with XNA Game Studio 4.0
RIS620 Advanced programming
From Navision To Microsoft
Microsoft Connect /17/2019 9:55 PM
Tips & Tricks Knowing the Web Client.
Microsoft Connect /23/ :38 AM
Introduction to Computer Science
Visual Studio Tools for Unity 2.0 Preview
Creating a 3D Simulation
5/6/2019 7:40 PM © Microsoft Corporation. All rights reserved. MICROSOFT MAKES NO WARRANTIES, EXPRESS, IMPLIED OR STATUTORY, AS TO THE INFORMATION IN THIS.
Introduction to Windbg
Agenda for Unit 1: Introduction of Computers and Games Graphics
Presentation transcript:

An Introduction to

What is XNA?  “A set of tools with a managed runtime environment provided my Microsoft that facilitates computer game development and management.” - Wikipedia, “Microsoft XNA”

What does it do?  Some Examples XNA Racer XNA Shooter Tetris Asteroids Assault Icebreaker

About XNA  Current version is 2.0, but 3.0 will be released in December 2008  Cross Platform (PC, Xbox 360, Zune)  C#  Free  “Boilerplate Code”  Content Pipeline  Programmable Graphics Pipeline

How do I get started?  Download Visual Studio 2005/2008 or Visual C# Express 2005/ default.aspx (the 2005 version might be harder to find) default.aspx  Download XNA Game Studio Installs over Visual Studio

Where can I learn more?  Huge online presence (Pick this one!)   XNA Special Interest Groups in the ACM

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.