1

2 CHAPTER 3 CELL ENGINEERING TECHNOLOGIES

1.Cell fusion, hybridization, and mAb 2.PCR, RT-PCR and real time PCR 3.Gene cloning, expression, and gene expression detection 4.Gene mutation and genetic mutation 5.Gene knockout, RNAi, and transgenic animals 6.Clone of cell, embryo, and individual body 7.Gene map and human genome program 8.Stem cell technology, iPS 9.Immunological technologies

4 1.Cell fusion, hybridization, and mAb 1. Cell fusion: Two or more cells are combined (fused) to form one cell and developed as one new cell clone or cell line. 2. Homokaryon fusion: The cell fusion between the cells with same gene types. 3. Heterokaryon fusion or hybridization fusion: The cell fusion between the cells with different gene types. 4. Tumor hybridization: The cell fusion between cancer cells and normal cells from different tissue types to form one hybridized cell with some special biological characters or functions, such as cultured in vitro unlimitedly. 5. Hybridization antibody (mAb): Fuse cancer cells with some specific B lymphocytes to form a hybridized cell clone to manufacture monoclonal antibody. Milstein and Kohler won the 1984 Nobel Prize because they created mAb technology in Methods: 1. Operations under a microscope performance system 2. Chemical reagent (PEG) 3. Electron fusion 4. By viruses

5 Hybridization fusion by SV (sendai-virus) Mouse Myeloma Cell Mouse B Lymphocyte Hybridized Cell Unlimitedly cultured and passaged Secret specific Ab A cell line can be cultured and passaged unlimitedly in vitro with specific Ab secretion + =

6 The advantages of mAb: 1.Very homogeneous and very specific even to a peptide because all of Ab molecules are just from one B cell clone; 2.Easy to be prepared and obtain a big quantity. The disadvantages of mAb: 1.Introduce the secondary Ab against itself because it is a powerful antigen to the mAb receiver’s immune system; 2.The secondary Ab can result in severe super allergen to the mAb receiver.

7 2. PCR and RT-PCR PCR (Polymerase Chain Reaction) is the most creative achievement in the molecular biology in past 30 years. “No PCR, no life science today”. The PCR creator, Kary Mullis, won the 1993 Nobel Prize on his great contribution. PCR is a reaction that replicates the DNA fragment following a DNA template in vitro, and can be designed and controlled willfully to meet the investigator’s needs.

8 Denaturation (94-95°C) Annealing (50-60°C) Extension (70-75°C) Recycles (25-35) Primer Template New synthesized Strand PCR products

9 PCR reaction system (Mixture): DNA polymerase dNTP Primer Template Ion (Mg+) Buffer A PCR program: 1. T=95˚, 3′ 2. T=52˚, 40" 3. T=72˚, 5 ′ 4. T=94˚, 1 ′ 5. T=52˚, 40" 6. T=72˚, 2 ′ 7. GOTO 4 REP T=72˚, 10 ′ 9. HOLD 4˚

10 Designation of PCR primers What should be known well at least before design primers: 1.Template gene and its sequence 2.How long sequence you want to amplify from the template 3.Vector’s MCS and your restriction enzymes selection, which enzyme you can choose, and which you can not Basic steps for the primer designation: 1.Check template and select the length of the PCR product (If wanted by project) 2.Select primer sequences and lengths, assemble them with restriction enzyme sites and protection sequence together 3.Type the sequences into software, and check the Tm and GC ratio 4.Make your primer pair matched 5.Select best primer pair

11 5’ 3’ Upper XXXXLower XXXX Sequence of EGFP, a template example: CGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACG GCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTG ACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGAC CTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCA TGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCC GAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGA CGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACA AGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTC GCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCT GAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCG TGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAA GCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGATCTAGATAA

12 Upper I4 Nhe I: 5’-AAAAAAGCTAGCCGCCACCATGGTGAGCA-3’ (Length: 29bp, TM: 70.4˚C, GC: 51.7%) Lower I4 Avr II: 5’-GGCCGGCCTAGGTTATCTAGATCCGGTGGA-3’ (Length: 30bp, TM: 70.4˚C, GC: 60%) This primer designation is not so good because of: 1.Tm is too high. Usually, it should be at from 55°C to 65°C 2.The last nucleotide at 3’ is A that is easy to form wrong match

13 A vector gene map and its MCS

14 PCR machine (Thermocycler)

15 3. Gene cloning, expression, and gene expression detection: Basic steps for a gene cloning project: a. Amplify the target gene and clone it into a suitable vector b. Transfect the recombinant into bacteria or eukaryotic cells to be expressed c. Screen the transfected bacteria or cells for positive clones d. Detect the expression level, gene function, or harvest the expression product …

16 Methods used to detect the gene expression: Real time PCR: mRNA Western blotting: Protein Histochemistry: Protein distribution or location Chemistry analysis: Changes of protein level and other linked features Changes of the Morphology and function of the expression host: Gene function Others: Changes of the bio-functions of host cells or animal; Changes of some special symptoms (for gene therapy), and other any changes based on the target gene expression.

17 4. Gene mutation and genetic mutation Site directed mutation and multiple sites directed mutation. Virtually, the mutation methods above are special PCR that can result in one or more sites mutated. Procedures: 1.Clone your target sequence into a plasmid and miniprep it from a dam+ E. coli strain, for example, DH5α 2.Primer designation 3.Run a mutation PCR with a powerful DNA polymerase 4.Use Dpn I to digest nonmutated dsDNA templates 5.Transfect bacteria with the reaction mixture and obtain clones 6.Miniprep of clones 7.Screen the correctly mutated clones by sequencing

18 Primers designation for site directed mutation: Both of the mutagenic primers must contain the desired mutation and anneal to the same sequence on opposite strands of the plasmid. Primer length: 25 – 45mer Mutated site should be in the middle of the primer with 10 – 15bp of correct sequence on both sides. Terminate in one or more C or G bases. Purify the primer with FPLC. Keep primer concentration in excess. Primer example [Mutate “Ser” (AGC) into “Arg” (CGC)] : Original template: 5´ CCA TGA TTA CGC CAA GAG CGC AAT TAA CCC TCA C 3’ Primers: 5´ CCA TGA TTA CGC CAA GCG CGC AAT TAA CCC TCA C 3’ 5´ GTG AGG GTT AAT TGC GCG CTT GGC GTA ATC ATG G 3´

19 Steps of the site directed mutation

20 5. Gene knockout, RNAi, and transgenic animals (RNAi makes gene knockdown, not knockout) Gene knockout: (1) Construct a recombinant to insert some exogenous genes into an exon of the genome to damage your target gene; (2) Transfect the recombinant into cells or introduce it into embryonic cell and screen out the positive cell clones or individuals to develop a gene knockout cell line or animal model.

21 RNAi: siRNA (19-25bp usually) can be understood as the follows: Small inhibiting RNA, small interfering RNA, short inhibiting RNA, or short interfering RNA. Synthesized siRNA fragments Vector expressed siRNA fragments Transfect or introduce into cells, tissue or animal RNAi Detect the expression level of the target gene, and observe the phenotype of target gene Both scientists from MIT and Stanford University won the Nobel prize in 2006 because of their great contribution for RNAi development.

22 Transgenic animals: The animal model with its some gene mutated, knockout, or some pathogenic gene expressed. 6. Clone of cell, embryo, and individual body Clone of cell: Usually, limit dilution method is used to clonize cells. Clone of embryo and individual body: The genes of embryo cells were changed or mutated New filial generations copulated each other (repeated) Screen out the individuals with some genetic features designated

23 7. Gene map and human genome program Gene map means the sizes (lengths) and locations of all genes and their control or regulation systems in a genome. About human genome program. About the Celera Genomics Group, a U.S. company I visited many times.

24 8. Immunological technologies (1) Check or display Ag or Ab in cells and tissues (2) Screen some library, such as, bio-panning (3) Detect gene’s function and expression (4) Classification of cell subtypes … …