Introduction to Bioinformatics Dot Plots

One of the simplest and oldest methods for sequence alignment Visualization of regions of similarity –Assign one sequence on the horizontal axis –Assign the other on the vertical axis –Place dots on the space of matches –Diagonal lines means adjacent regions of identity

Simple Example Construct a simple dot plot for GCTGAA GCGAA One sequence goes horizontally, the other vertically Mark boxes w/ matched horizontal and vertical symbols Look for diagonal(s) Alignment: GCTGAA GCT-AA GCTGAA G** C* T* A* A*

Another Example Construct a simple dot plot for GCTAGTCAGATCTGACGCTA GATGGTCACATCTGCCGC A long stretch of nearly identical residues is revealed starting at the fifth nucleotide of each sequence (GTCA-ATCTG-CGC).

Sliding Window and Cutoff Problem –Plot becomes noisy when comparing large, similar sequences Solution –Sliding window (size = w) –Cutoff (value = v) –Consider w nucleotides at a time –When at least v matches in a window, place a dot on the space where the window starts

Example Same example with w = 4 and v = 3 Compare to the previous plot. You make the call!

Worksheet w = 4 and v = 3

What else can it do (and how)? Gaps Inverse subsequence Repeats Palindrome Genome rearrangement Exon identification RNA structure prediction Nice tool for conceptualizing sequence- related algorithms