Replication and Central Dogma January 2009. DNA structure and properties.

Slides:

Advertisements

Similar presentations

Protein Synthesis Let’s make some protein!. Protein Synthesis: An Overview Genetic information is contained within the nucleus of a cell DNA in the nucleus.

Advertisements

DNA Transcription and Translation

Lecture I Intro to Genetics & DNA Replication with a review in DNA, RNA, & Protein Synthesis.

Hosted by The Greatest Biology teachers at Rider.

2.7 DNA Replication, transcription and translation

1 Vocabulary Review Nucleic Acids. 2 Enzyme that unwinds & separates the DNA strands Helicase.

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

1. A mutation occurs at the midpoint of a gene, altering all amino acids encoded after the point of mutation. Which mutation could have produced this.

GENE EXPRESSION. Root Words to Know Trans = acrossScript = write Poly = manySynth = make.

Protein Synthesis. DNA in the Cell The Central Dogma DNA  RNA  Protein.

RNA StructureandFunction Transcription Translation.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

How Genes Work. Structure of DNA DNA is composed of subunits – nucleotides Three parts Deoxyribose (5-carbon sugar) Phosphate group Nitrogen base – 2.

Chapter 11 DNA and GENES. DNA: The Molecule of Heredity DNA, the genetic material of organisms, is composed of four kinds nucleotides. A DNA molecule.

Notes: Protein Synthesis

DNA RNA DNA Replication & Transcription Translation.

RNA and Protein Synthesis

One gene=one protein RNA & Protein Synthesis. Genetic Code -Universal All living organisms have the same four nucleotides- A, C, T, & G Central Dogma:

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

RNA. What is RNA?  RNA stands for Ribonucleic acid  Made up of ribose  Nitrogenous bases  And a phosphate group  The code used for making proteins.

Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.

Protein Synthesis: Protein Synthesis: Translation and Transcription EQ: What is the Central Dogma and what processes does it involve? Describe processes.

Structure of DNA DNA is made up of a long chain of nucleotides

Chs. 11 and 12 Clicker Quiz! Get your clickers ready! 8 questions.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

YouTube - "The Gene Scene". The Structure of RNA There are three main differences between RNA and DNA. 1. The sugar in RNA is ribose instead of deoxyribose.

Protein Synthesis Part I. Transcription.

Jeopardy DNAs mRNA Amino Acids ETC Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final Jeopardy tRNA.

Protein Synthesis. The genetic code This is the sequence of bases along the DNA molecule Read in 3 letter words (Triplet) Each triplet codes for a different.

Composed of 4 nucleotides, that always pair the same.

The Central Dogma 12.3 HW tonight read 12.4 and review this stuff!

The Central Dogma of Biology Why It’s Important DNA contains instructions for making proteins, which determine an organism’s traits.

The Central Dogma of Molecular Biology DNA  RNA  Protein  Trait.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Chapter 12.3 Gene Activity. GENES SPECIFY ENZYMES (PROTEINS)

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

Protein Synthesis: Transcription and Translation

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Protein Synthesis.

From DNA to Proteins Transcription.

The DNA Connection.

Chapter 21 DNA and Biotechnology.

Biology Unit 4 Notes: RNA & Protein Synthesis

The making of proteins for …..

Warm-up Go to the table with the trait you have answer the following questions On a post-it answer the following questions and post on the nearest parking.

DNA Test Review.

Transcription & Translation.

REPLICATION, TRANSCRIPTION & TRANSLATION REVIEW Power point

DNA Transcription & Protein Translation

Unit 5: Protein Synthesis.

REPLICATION, TRANSCRIPTION & TRANSLATION REVIEW Power point

Protein Synthesis Miss Richardson SBI4U.

Transcription and Translation

RNA: Structures and Functions

RNA carries DNA’s instructions.

REVIEW DNA DNA Replication Transcription Translation.

How does the body use DNA to create proteins? CENTRAL DOGMA

Making Proteins Transcription Translation.

Gene Expression aka Protein Synthesis.

Steps of Translation.

Transcription and Translation

DNA Transcription and Translation

Transcription and the RNA code

Unit 3: Genetics Part 1: Genetic Informaiton

Presentation transcript:

Replication and Central Dogma January 2009

DNA structure and properties

During an ocean exploration you discover ancient colelancanth DNA. You denature your DNA and discover that a single strand is composed of: 10% A, 10% T, 45% C and 45%G Which of the following could you conclude: A. Base-pairing in colelanth DNA follows the same rules as human DNA. B. Base-pairing in colelanth DNA follows different rules than human DNA. C. You need more information

If a single stranded DNA molecule is composed of 40% thymine, what percentage of guanine would be expected? A. 10% B. 20% C. 30% D. 40% E. Need more information

Transcription

Now let’s look at transcription DNA to RNA in more detail… Where does transcription start? A.Promoter B.AUG start codon C.The promoter and the AUG start codon are the same thing

Amy Roloff from “Little People, Big World” has a mutation in her FGFR3 gene. Part of the DNA sequence from Amy’s FGFR3 gene is: os/amy.html A. 3’AGCUACAGGGUG 5’ B. 5’AGCUACAGGGUG 3’ C. 3’UCGAUGUCCCAC 5’ D. 5’UCGAUGUCCCAC 3’ Coding strand 5’ AGCTACAGGGTG 3’ 3’ TCGATGTCCCAC 5’ Template strand What is the sequence of Amy’s FGFR3 mRNA?

Matt Roloff from the TV show “Little People, Big World” has a mutation in his SLC26A gene. Part of the DNA sequence from Matt’s SLC25A gene is: A. 3’CGCUACAGAGUG 5’ B. 5’CGCUACAGAGUG 3’ C. 3’GCGAUGUCUCAC 5’ D. 5’GCGAUGUCUCAC 3’ Coding strand 5’--Promoter-- CGCTACAGAGTG 3’ 3’ GCGATGTCTCAC 5’ Template strand What is the sequence of Matt’s mRNA?

5’5’ CGTATAGGCTGATGTGGCAC 3 ’ 3’3’ GCATATCCGACTACACCGTG 5 ’ Which of the following would be the correct product of transcription from this DNA sequence? The arrow shows the transcription start site. A. 5 ’ GTGCCACATCA 3 ’ B. 5 ’ GUGCCACAUCA 3 ’ C. 5 ’ TGATGTGGCAC 3 ’ D. 5 ’ UGAUGUGGCAC 3 ’ E. 5 ’ ACUACACCGUG 3 ’

Translation

What is the amino acid sequence of Amy’s FGFR3 protein? A. Ser-Tyr-Gly-Val B. Ser-Tyr-Arg-Val C. Arg-Tyr-Lys-Val D. Gly-Tyr-Val-Val os/amy.html mRNA 5’AGC UAC AGG GUG 3’

If you use a computer program that allows you to take a known DNA sequence and ‘translate’ it into an amino acid sequence of a protein, how many possible amino acid sequence(s) could you get from a single DNA sequence? A. 1 B. 3 C. 6 D. many

How are proteins are made? A.Transcription of the DNA to a protein B.Translation of the pre-mRNA to a protein C.Transcription of the mRNA to a protein D.Translation of the mRNA to a protein E.Translation of a string of amino acids

What best describes the genetic code? A. The way ribosomes recognize genes in mRNA B. The order of nucleotides in a gene from which a protein is made. C. A unique set of 24 nucleotide triplets needed to translate mRNAs. D. The set of all possible 64 nucleotide triplets from 4 bases (4 3 = 64)