pGLO lab

The importance of DNA

The DNA double helix is the code of life DNA is the code to make proteins The blueprint for all structures in your body which are made of protein DNA is comprised of nucleotides

Nulceotides are the monomers of nucleic acid polymers Consist of a sugar, a phosphate, and a nitrogen-containing base Sugar can be deoxygenated Bases contain the genetic information

There are 4 kinds of DNA bases

Adenine always matches with Thymine, Cytosine always matches with Guanine- Hydrogen bonds hold bases together

Living things are extremely complex Cellular machinery is sophisticated and required for life Cellular machinery is made largely of proteins Blueprints for all cellular machinery are contained in genes Genes are inherited from parents Humans have ~30,000 genes

Proteins give living things the variety of their structures

Protein variety is generated by 1 o structure- the sequence of amino acids which make the protein

Figure 2.12 Amino Acids Proteins consist of subunits called amino acids

How DNA works Replication Transcription Translation

The sequence of DNA bases is the code for the primary structure of proteins

All cells require a copy of the genome Genome- all the genes of the cell Human genome is made of DNA DNA is similar in all cells Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein) DNA replication copies all cellular DNA

Replication of DNA Figure 21.2

The DNA code

Computers use binary digital code = A =B =c = apostrophe Etc. notes.com/tools/17/tex t-to-binary-translator/ = cheeseburger deluxe

How does the DNA code work? atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaa gttcgtatggaaggttccgttaacggtcacgagttcgaaatcga aggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgct aaactgaaagttaccaaaggtggtccgctgccgttcgcttggga catcctgtccccgcagttccagtacggttccaaagcttacgttaa acacccggctgacatcccggactacctgaaactgtccttcccgg aaggtttcaaatgggaacgtgttatgaacttcgaagacggtggt gttgttaccgttacccaggactcctccctgcaagacggtgagttc =GFP

The DNA code is (nearly) universal It uses groups of 3 bases (codon) 3 bases = 1 codon = 1 amino acid

The Central Dogma of Molecular Biology DNA  RNA  Protein DNA  RNA : Transcription RNA  Protein: Translation

DNA  RNA  Protein  Trait

The Universality of the DNA code makes this possible Firefly gene (Luciferase) in a tobacco plant

tRNA’s carry an amino acid at one end, and have an anticodon at the other Figure 21.6 Amino acid (phenylalanine) mRNA Anticodon Amino acid attachment site: Binds to a specific amino acid. Anticodon: Binds to codon on mRNA, following complementary base-pairing rules.

The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence

In this way, the proteins in nature are virtually limitless

Proteins are incredibly diverse at the molecular level Insulin ATP synthase Rubisco Nitrogenase Fibrin A few examples Protein function depends greatly on shape

Because the DNA code is universal, genes can be moved from one living thing to another Figure (1 of 2) Step 1: Isolate DNA from two sources. Step 2: Cut both DNAs with the same restriction enzyme. Step 3: When mixed, the DNAs recombine by base pairing. Bacterium Plasmid Cell with gene of interest Source (donor) DNA Fragments of source DNA

When one DNA molecule is copied to make two DNA molecules, the new DNA contains 1. A) 25% of the parent DNA. 2.B) 50% of the parent DNA. 3.C) 75% of the parent DNA. 4.D) 100% of the parent DNA. 5.E) none of the parent DNA.

DNA in action HIV and AIDS Genetic engineering pGLO

Genetic Engineering allows DNA to be moved from one organism to another Figure 21.14

Green Fluorescent Protein discovered in 1960s by Dr. Frank Johnson and colleagues closely related to jellyfish aequorin absorption max = 470nm emission max = 508nm 238 amino acids, 27kDa “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore amino acid substitutions result in several variants, including YFP, BFP, and CFP 40 Å 30 Å

The pGLO plasmid has genes which can be turned on and off ori- origin of replication GFP- green fluorescent protein bla- Beta-lactamase araC- Arabinose What are all the other marks? Why are they there?

2008 Nobel Prize- GFP GFP mice

Gene Regulation RNA Polymerase araC ara GFP Operon GFP Gene araC GFP Gene araC GFP Gene Effector (Arabinose) BAD araC BAD RNA Polymerase Effector (Arabinose) araC BAD ara Operon On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP What will happen on the Ara (+) plates? What will happen on the Ara (-) plates ?

9/8/ Grow? Glow? Follow protocol On which plates will colonies grow? Which colonies will glow?