17.4 – Protein Synthesis and Gene Expression gene expression – the transfer of genetic information from DNA to protein As described.

Slides:



Advertisements
Similar presentations
Gene Expression and Control Part 2
Advertisements

Nucleic Acids and Protein Synthesis
RNA and Protein Synthesis
1 Gene expression Transcription and Translation 2 1.Important Features a. DNA contains genetic template for proteins. b. DNA is found in the nucleus.
How Are Genes Expressed? Chapter11. DNA codes for proteins, many of which are enzymes. Proteins (enzymes) can be used to make all the other molecules.
RNA and Protein Synthesis
Cell Protein Production
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.
1. Important Features a. DNA contains genetic template" for proteins.
PROTEIN SYNTHESIS.
8.4 DNA Transcription 8.5 Translation
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
Biology 10.1 How Proteins are Made:
Making of Proteins: Transcription and Translation
Protein Synthesis DNA is transcribed into Messenger RNA. Messenger RNA is translated into Protein.
FROM DNA TO PROTEIN Transcription – Translation We will use:
Hemophilia- Caused by a defect in a single gene cannot produce all the proteins necessary for blood clotting Depend on expensive injections of clotting.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.
FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.
What is the job of p53? What does a cell need to build p53? Or any other protein?
1 Gene expression Transcription and Translation. 2 1.Important Features: Eukaryotic cells a. DNA contains genetic template for proteins. b. DNA is found.
1 Genes and How They Work Chapter Outline Cells Use RNA to Make Protein Gene Expression Genetic Code Transcription Translation Spliced Genes – Introns.
RNA and Protein Synthesis
Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.
Protein Synthesis Process that makes proteins
12-3 RNA and Protein Synthesis
Chapter 7 Gene Expression and Control Part 2. Transcription: DNA to RNA  The same base-pairing rules that govern DNA replication also govern transcription.
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)
PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.
RNA AND PROTEIN SYNTHESIS
Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.
Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.
REPLICATION IN BACTERIA Replication takes place at several locations simultaneously Each replication bubble represents 2 replication forks moving in opposite.
Structure of DNA DNA is made up of a long chain of nucleotides
Protein Synthesis How genes work.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.
PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.
Ch 12-3 Notes, part 2 The Central Dogma = Protein Synthesis.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Transcription and Translation Chapter 21. Objectives Summarize how genetic information is encoded in DNA, how it provides instructions for making proteins.
CHAPTER 10 “HOW PROTEINS ARE MADE”. Learning Targets  I will compare the structure of RNA with that of DNA.  I will summarize the process of transcription.
8.3 DNA Replication KEY CONCEPT DNA replication copies the genetic information of a cell.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.
Transcription and Translation HL 2014!
Section 20.2 Gene Expression
FROM DNA TO PROTEIN Transcription – Translation
Basics of RNA structure and modeling
How to Make a Protein?.
RNA and Protein Synthesis
Transcription & Translation.
Biology Chapter 10 Section 1 Part 2
Genes and How They Work Chapter 15
RNA and Protein Synthesis
Cell Protein Production
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Transcription Steps to Transcribe DNA:
GENE EXPRESSION / PROTEIN SYNTHESIS
Steps of Translation.
RNA.
DNA and the Genome Key Area 3c Translation.
Presentation transcript:

17.4 – Protein Synthesis and Gene Expression gene expression – the transfer of genetic information from DNA to protein As described earlier, DNA is the genetic material in living things which gives the blueprint of how an organism develops. This blueprint, however, has to be put into a useful or structural form. In most living things, the main structural molecule is protein. Hence, DNA provides the blueprint for all the different proteins found in living organisms Examples of protein structures: 1) skeletal muscle tissue4) enzymes 2) smooth muscle tissue5) transporters in cell membranes 3) hormones However, DNA is not directly used to make protein. Instead, DNA is copied to RNA, and RNA is used to make protein. This leads us to the central dogma of gene expression, proposed by Francis Crick. DNA → RNA → protein The use of DNA to produce RNA is called transcription. The use of RNA to make protein is called translation.

The Genetic Code Recall that in humans there are 20 amino acids (the basic units of proteins). However, there are only 4 different nucleotides. Therefore, if it only took 1 nucleotide to code for 1 amino acid only 4 amino acids could be produced. If 2 nucleotides in a row coded for 1 amino acid, you still could not code for all 20 amino acids (only 16 possible combinations). It takes combinations of 3 nucleotide sequences to code for 1 amino acid Codon – the basic unit, or “word”, of the genetic code. It is a set of 3 adjacent nucleotides in DNA or mRNA that codes for amino acid placement on polypeptides. (see table 17.2, p. 590) Characteristics of the genetic code → more than one codon can code for an amino acid ex. UCA, UCU, UCG, and UCC all code for serine → it is continuous (no spaces or overlap) → universal code – is almost the same in all living things

Transcription (see fig 17.28, p. 591) The main job of transcription is to make a RNA copy of a small section of the organism’s DNA (the particular gene needed to make a specific protein) Messenger RNA (mRNA) – strand of RNA that carries genetic information from DNA to the protein synthesis machinery of the cell during transcription RNA polymerase – main enzyme that catalyses the formation of mRNA from a DNA template Sense strand – strand of nucleotides containing the instructions that direct protein synthesis. It is located within a stretch of DNA that includes a gene (not transcribed) Antisense strand – strand of nucleotides that is complimentary to the sense strand (transcribed)

Steps in Transcription 1) Initiation → RNA polymerase binds to a particular sequence of nucleotides in the sense strand → RNA polymerase opens up the double helix and begins inserting complimentary RNA nucleotides 2) Elongation → proceeds in the 5’ to 3’ direction (no Okazaki fragments) → as the polymerase molecule proceeds, the DNA helix reforms and the mRNA molecule separates from the template DNA strand 3) Termination and processing → the RNA polymerase proceeds until it reaches a signal to stop and the RNA polymerase and mRNA completely separate from the DNA molecule → a special sequence of nucleotides is added to the 5’ and 3’ ends → introns are spliced out (removed), leaving only the exons → the mRNA is transported out of the nucleus

Translation (see fig 17.29, p. 593) Translation occurs outside the nucleus in eukaryotic cells, and involves several elements in order to occur. Transfer RNA (tRNA) – RNA molecules that serve to link each codon along a mRNA strand with its complimentary amino acid Transfer RNA has an unusual structure. They have a cloverleaf shape (single-stranded), and they contain an anticodon. Anticodon – specialized base triplet located at one lobe of a tRNA molecule that recognizes its complimentary codon on an mRNA codon At the 3’ end of a tRNA is an amino acid transport site. Ribosomes – tiny two part structures found in the cell’s cytoplasm and attaches to the rough endoplasmic reticulum that helps to put together proteins. They bring together the mRNA strand, tRNA molecules carrying amino acids, and the enzymes involved in building proteins. Ribosomal RNA (rRNA) – most common class of RNA molecules. During protein synthesis, these RNA molecules supply the site on the ribosome where the polypeptide is assembled.

The Translation Cycle 1. mRNA binds to an active ribosome in such a way to expose two adjacent codons. 2. The first tRNA molecule (carrying the amino acid methionine) binds to the codon AUG (start codon). 3. A second tRNA molecule carrying an amino acid arrives at the codon adjacent to the first tRNA. 4. Enzymes catalyze the formation of a peptide bond that joins the amino acid carried by the first tRNA to that carried by the second tRNA. At the same time, the polypeptide chain is transferred from the first tRNA to the second. 5. The ribosome moves a distance of one codon along the mRNA strand. The first tRNA molecule detaches from the mRNA and goes to pick up another amino acid. The second tRNA now holds a growing polypeptide chain. A third tRNA molecule arrives at the exposed codon next to the second tRNA and the cycle repeats. 6. When a “stop” codon is reached (UAG, UGA, UAA), the completed protein is released and the ribosome assembly comes apart.

Regulating Gene Expression The rates of transcription and translation can be controlled to adjust to environmental conditions. For example, artic foxes have white fur in winter, but brown in warmer temperatures. Factors that affect transcription and translation in living cells: 1) changes in temp. or light 2) the presence or absence of nutrients in the environment 3) the presence of hormones in the body