The Case of PKU: From Genes to Proteins Team EUREKA! Norris Armstrong Bill Barstow Peggy Brickman Phil Cunningham Mike Hanna Dave Njus Bill Wischusen Michelle Withers Facilitators: Lillian Tong & Millard Susman

Teaching Challenge Students: –have difficulty visualizing the role of the key components in translation. –become mired in the details of transcription/translation & miss larger concept about how genotype determines phenotype. –see molecular processes of gene expression as separate from classical genetics/inheritance.

Learning Objectives Science Content: –Students will learn that genes influence phenotype by determining amino acid sequence of proteins. –Students will learn the mechanisms for transcribing RNA from DNA. –Students will learn the mechanisms for translating RNA to protein.

Science Skills: –Predict from a nucleotide sequence the appropriate amino acid sequence. –Predict how a change in nucleotide sequence would potentially affect protein structure. –Evaluate the impact of different alleles on phenotype. –Communicate the relationship between genotype and phenotype. Learning Objectives

General Skills: –Students will acquire information and knowledge through investigation. –Students will interpret data and solve problems. Learning Objectives

Which of the following best describes the relationship between a gene and DNA? a)A gene is composed of many DNA molecules b)A gene is converted into DNA in the nucleus c)A gene is a portion of a DNA molecule d)A gene is used to make DNA e)There is no relationship between the two Pre-Activity Assessment How is the information stored in DNA? a)In the sequence of amino acids b)In the sequence of nucleotides c)In the sequence of covalent bonds d)In the sequence of phosphate groups

Within the following DNA sequence, which nucleotides would produce the amino acid chain shown below? 3’CGGTCGTACAGGTGACGCCAG 5’GCCAGCATGTCCACTGCGGTC Met-Ser-Thr-Ala-Val Group Activity (What information do you need to know in order to determine this sequence of amino acids? )

If the DNA sequence below were shortened by removing the highlighted nucleotide what would be the expected result when compared to the original? 3’CGGTCGTACAGGTGACGCCAGC5’ a) The amino acid sequence would be unchanged. b) The sequence will be shortened by one amino acid. c) The amino acid sequence would shortened by several amino acids. d) There would be a different sequence of amino acids after the deletion. e) No product would be produced. Post-Activity Assessment

Day 2 Prior Knowledge Assessment Student Group Activity –Mechanics of translation (Chain Elongation) Mini-lecture/discussion on initiation and termination. Post Activity Assessment

Day 3 Open with video clip of PKU patient. Student Activity: Correlate the changes in nucleotide sequence of PKU alleles with amino acid and phenotypic changes with embedded assessment. Summative assessment.

Core Themes: Diversity Diversity of the student population: –High level of Nutrasweet® exposure. –PKU that affects all populations at significant frequency. Diversity of learning styles: –Reading and unguided exploration. –Discussion, reflection, and prediction during activities. –Visuals like animations, video clips, and figures.

Core Themes: Diversity Diverse Teaching Techniques: –Collaborative-team learning activities that include communicating different problem solving strategies. –Inquiry-driven mini-lectures –Teacher-guided discussions –Student-guided web searches.

Core Themes: Active Learning Exploration and emotional hook using PKU Collaborative Group Activities –Students uncover the genetic code and relationships between gene and protein by converting PKU gene to protein. –Instead of covering the stages of translation, students uncover by ordering the stages of an unmarked cartoon.

A Arrange the following in order: C

Core Themes: Assessment During each class period students will complete a pre-activity assessment including in-class questions testing prior knowledge and/or comprehension of previously covered material. Each class periods’ activities are either followed by in-class questions or embedded assessment utilizing student presentations or written explanations a specific process or concept. These will be evaluated using a assessment rubric. At the end of the teachable module students will be assessed using a variety of in class questions.