Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

Slides:

Advertisements

Similar presentations

Replication, Transcription, & Translation

Advertisements

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

Cell Protein Production

PROTEIN SYNTHESIS.

DNA: Transcription & Translation How do we go from DNA to PROTEIN?

Section 2 From DNA to Protein

RNA and Protein Synthesis. DNA to RNA to Protein Focus Questions: –How does the message coded in the base sequence of DNA eventually create a protein?

DNA Deoxyribonucleic Acid Chapter 11 Page 287. What is DNA? The information that determines an organisms traits. DNA produces proteins which gives it.

RNA Ribonucleic acid single stranded also made of nucleotides.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Transcription and Translation

RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.

RNA & Protein Synthesis.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

RNA and Protein Synthesis What is a gene? A region of DNA that contains instructions for the making of proteins. A region of DNA that contains instructions.

Chapter From DNA to Protein.

DNA Replication to Transcription to Translation. DNA Replication Replication : DNA in the chromosomes is copied in the nucleus. DNA molecule is unzipped.

Transcription & Translation Chapter 17 (in brief) Biology – Campbell Reece.

RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.

RNA and Protein Synthesis

One gene=one protein RNA & Protein Synthesis. Genetic Code -Universal All living organisms have the same four nucleotides- A, C, T, & G Central Dogma:

12-3 RNA and Protein Synthesis

DNA Review Sheet Answers 1.Determines an organism’s traits; molecule of heredity 2.Hershey and Chase 3.Made of nucleotides 4.Adenine Thymine Cytosine Guanine.

RNA Structure and Protein Synthesis Chapter 10, pg

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Structure of RNA  Structure  Nucleic acid made up of nucleotides  composed of Ribose, phosphate group, and nitrogenous base  Nitrogenous bases  Adenine.

How does DNA control cell activities?. Protein Production The sequence of nucleotides in DNA contains instructions for producing proteins. The sequence.

RNA AND PROTEIN SYNTHESIS

RNA Another Nucleic Acid.

Chapter 11: DNA & Genes Sections 11.1: DNA: The Molecular of Heredity Subsections: What is DNA? Replication of DNA.

DNA Deoxyribonucleic Acid. DNA Structure What is DNA? The information that determines an organisms traits. DNA produces proteins which gives it “The.

Chapter 13 –RNA and Protein Synthesis

Translation Section 11-2 cont.. Transcription Translation 20 different amino acids 20 different amino acids A group of three nucleotides in mRNA code.

Structure of DNA DNA is made up of a long chain of nucleotides

Objective Explain the function and structure of RNA. Determine how transcription produces a RNA copy of DNA. Analyze the purpose of transcription.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Transcription & Translation. Objectives: Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involved in protein.

Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.

Chapter  Relate the concept of the gene to the sequence of nucleotides in DNA  Sequence the steps involved in protein synthesis ◦ DNA  mRNA =

Protein Synthesis. Prior Knowledge Protein: Large complex molecule that is essential to all life Synthesis: to build, put together Protein Synthesis:

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

RNA and Protein Synthesis

Protein Synthesis.

Protein Synthesis.

RNA Another Nucleic Acid.

Protein Synthesis.

Objective: Journal: Describe the process of protein synthesis

Transcription and Translation

RNA Ribonucleic Acid.

Chp: 12 Transcription & Translation

From DNA to Proteins.

DNA & Protein Synthesis

12-3 RNA and Protein Synthesis

From Genes to Proteins.

RNA and Transcription DNA RNA PROTEIN.

Cell Protein Production

PROTEIN SYNTHESIS = CELL CONTROL

January 11, 2018 Objective: Journal:

Protein Synthesis RNA.

12-3 RNA and Protein Synthesis

Translation and Transcription

From Genes to Proteins.

Protein Synthesis.

Protein Synthesis.

Presentation transcript:

Chapter 11 DNA and Genes

Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of nucleotides in DNA.

Exons Regions of genes that contain information.

Introns Long noncoding nucleotide sequences located in genes.

RNA Nucleic acid. Single stranded. Formed from a phosphate group, the sugar ribose, and four nitrogenous bases ( adenine, guanine, cytosine, and uracil ).

Transcription Process where enzymes make an RNA copy of a portion of a DNA strand.

RNA and Protein Synthesis RNA uses the instructions provided by DNA to assemble proteins, amino acid by amino acid.

Translation Takes place at the ribosomes. The process of converting the information in mRNA into a sequence of amino acids in a protein.

Three Types of RNA 1. Messenger RNA 2. Ribosomal RNA 3. Transfer RNA

mRNA Brings instructions from DNA in the nucleus to ribosomes located in the cytoplasm where protein synthesis occurs.

mRNA Uses a combination of three nitrogenous bases, called a codon, to code for one of 20 common amino acids. There are 64 codons possible. Some codons code for instructions such as start (AUG) and stop (UAA). The same amino acid can have more than one codon.

mRNA During transcription, both introns and exons are copied. However, the introns must be removed from the mRNA by enzymes and the resulting exon pieces pasted back together before it the mRNA can move out of the nucleus and function to make a protein.

rRNA When mRNA reaches the ribosome, rRNA binds to the mRNA and uses the instructions provided to assemble the amino acids in the correct order.

tRNA Delivers amino acids to the ribosome where they are assembled into proteins. Each tRNA molecule attaches to only one type of amino acid.

tRNA A sequence of three nucleotides, called an anticodon, is located on the side of the tRNA opposite the amino acid attachment site. The anticodon of the tRNA binds to the correlating codon on the mRNA, insuring correct translation of the mRNA message.

Steps in Translation 1...\..\..\AP Bio\Bio in focus PP\Chapter_14\C_Animations_and_ Videos\14_BioFlix_Animations\10_Pro tein_Synthesis\PC\ProteinSynthesis.m pg..\..\..\AP Bio\Bio in focus PP\Chapter_14\C_Animations_and_ Videos\14_BioFlix_Animations\10_Pro tein_Synthesis\PC\ProteinSynthesis.m pg

Steps in Translation 1. A tRNA molecule brings the first amino acid to the mRNA strand which is attached to a ribosome. 2. The anticodon of the tRNA forms a base pair with the corresponding codon of the mRNA. 3. The ribosome slides down the mRNA chain to the next codon.

Steps in Translation 4. A new tRNA molecule carrying a second amino acid pairs with the new codon. 5. The two amino acids that are now adjacent to each other form a bond. 6. The first tRNA releases its amino acid and detached forms the mRNA, in order to bring another amino acid to the chain.

Steps in Translation 7. The ribosome slides down to the next codon and the previous steps are repeated. 8. This process continues, forming a chain of amino acids, until a stop codon is reached, where translation ends and the amino acid chain is released form the ribosome.

Steps in Translation 9. Amino acid chains become proteins when they are freed from the ribosome and twist and curl into complex 3-D shapes. Each protein chain forms the same shape every time it is produced.