Protein Synthesis AP Biology Ch. 17

“One Gene-One Polypeptide” Theory George Beadle and Edward Tatum (late 40’s to early 50’s) used X-rays to induce mutations in Neurospora crassa (bread mold) Auxotrophs—nutritional mutants unable to synthesize certain amino acid and vitamins. They traced the defect to the enzymes involved in their synthesis. Conclusion: One gene encodes one enzyme. Gene products encode both protein and RNA

Central Dogma of Molecular Biology In eukaryotic cells, a message (mRNA) carries the genetic information (DNA) from the nucleus to the cytoplasm  Transcription An adapter (tRNA) translates the nucleic acid (mRNA) into amino acid (protein)  Translation Information flow is unidirectional GCTGCTAACGTCAGCTAGCTCGTAGCGCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAG RNA Proteins

Structure of RNA Single strand of nucleotides [instead of 2 strands in DNA] Nucleotides contain 5-carbon sugar ribose [instead of deoxyribose in DNA] 4 different nitrogenous bases Adenine (A) Uracil (U) [instead of thymine in DNA] Cytosine (C) Guanine (G)

Forms of RNA 3 Main Types of RNA mRNA (messenger RNA) brings DNA message out of nucleus to the cytoplasm Each 3 bases on mRNA is a “codon” tRNA (transfer RNA) –The anticodon that matches with the codon from mRNA to determine which amino acid joins the protein chain rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules

Transcription: Synthesis and Processing of RNA RNA Polymerase is an enzyme that synthesizes RNA using one strand of the DNA as a template Separates 2 strands of DNA and links RNA nucleotides as they base-pair along the DNA template in an overall is 5’ to 3’ direction

Transcription: Initiation RNA polymerase attaches to promotor sequence (TATA box) of DNA sequence Prokaryotes—enzyme binds directly to sequence Eukaryotes—enzyme binds after transcription factors bind to the site

Transcription: Elongation RNA polymerase Synthesizes in 5’ 3’ direction, anti-parallel to DNA template Unwinds about 20 base pairs as it reads and synthesizes complementary RNA

Transcription: Termination RNA polymerase terminates transcription at special DNA sequences, terminator Prokaryote—stops right at the end of termination signal Eukaryote—continues past termination signal, to a poly(A) tail (AAUAAA) in the pre-mRNA

Transcription The code on DNA tells how mRNA is put together. Example: DNAACCGTAACG mRNAUGGCAUUGC Each set of 3 bases is called a triplet or codon (in mRNA) UGG CAU UGC

RNA Splicing Pre-mRNA never leaves the nucleus Introns—non-coding regions Exons—coding regions snRNPs join with other proteins to form spliceosome, which releases introns

Translation Genetic information in mRNA is read by codons 64 different codons Genetic code is redundant—more than one codon codes for many of the 20 amino acids AUG—universal start codon UAA, UAG, UGA—stop codons

Structure of tRNA

Aminoacyl-tRNA Formation

Structure of a Ribosome

Translation: Initiation Small ribosomal subunit binds to start codon (AUG) on mRNA Initiator tRNA (UAC) base-pairs with mRNA Large ribosomal unit binds so initiator tRNA is in the P site GTP provides energy for intiation process

Translation: Elongation

Translation: Termination Review entire process

Polyribosomes

Coupled Transcription and Translation in Bacteria

Point Mutations

Substitution Mutations Missense mutation: altered codon still codes for an amino acid, although maybe not the right one Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely Leads to nonfunctional proteins

Insertions and Deletions Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made

The end

5’ 3’ Ribosome U U C U G G A U G U G G U U C U G G mRNA A U C C A Reading direction mRNA A U C Met C A Trp Incoming tRNA charged with amino acid A U C Met

5’ 3’ Ribosome mRNA U U C U G G A U G U G G U U C U G G A C A G U Reading direction mRNA C A Trp U Outgoing “empty” tRNA Met A G Phe

5’ 3’ Ribosome mRNA U U C U G G A U G U G G U U C U G G G A C A C U Reading direction mRNA C A Trp Met G Phe U C A Trp

5’ 3’ Ribosome mRNA U U C U G G A U G U G G U U C U G G A C G U Reading direction mRNA C A Trp Phe G U Met

5’ 3’ Ribosome mRNA U U C U G G A U G U G G U U C U G G U A C Incoming tRNA charged with amino acid Ribosome 5’ 3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA A C Trp Anticodon G Phe Outgoing “empty” tRNA U Met Amino acid