Protein Synthesis Human Biology

DNA Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides Composed of alternating sugar (Deoxyribose) and phosphate molecules and Nitrogen bases Purines = adenine and guanine Pyrimidines = thymine cytosine

DNA Purines bond with Pyrimidines Complementary base pairs Adenine with Thymine Guanine with Cytosine

DNA Purines bond with Pyrimidines Complementary base pairs Adenine with Thymine Guanine with Cytosine Nucleoside Sugar bonding with a base Nucleotide Adding a phosphate to a nucleoside Phosphates attach to the 5’ carbon of the sugar

Orientation of DNA The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone. The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone. The carbon atoms on the sugar ring are numbered for reference. The 5’ and 3’ hydroxyl groups (highlighted on the left) are used to attach phosphate groups.

DNA is a double helix P A P C P G P T P C P G P A P C P T G P P C P A sugar and phosphate “backbone” connects nucleotides in a chain. P G P Two nucleotide chains together wind into a helix. DNA strands are antiparallel. DNA has directionality. 5’5’ 3’3’ 3’3’ 5’5’ Hydrogen bonds between paired bases hold the two DNA strands together.

DNA A chromosome 23 pair = diploid 23 = haploid; sex cells Duplicating DNA structure tightly packed around histone proteins to form a nucleosome.

DNA and Genes

DNA DNA contains genes Genes are the codes for polypeptides (proteins)

DNA Gene A series of bases that occupy a specific location (locus) on a chromosome The code of a single protein or polypeptide Genetic Alphabet Triplet = Three nucleotides on DNA with their corresponding base pairs making up the code of a single amino acid Codon = Three successive nucleotides on RNA with their corresponding base pairs making up the code of a single amino acid 20 amino acids A series of amino acids makes up a protein

DNA Consists of 3 billion base pairs Codes for about 50 to 100,000 genes Genes may exist in alternate forms = alleles One allele from mom and one allele from dad Nucleotide changes or mutations may occur in a gene Sickle cell anemia In a healthy population, a gene may exist in multiple alleles Genetic Polymorphism = Multiple different forms at a gene locus in a population Basis for DNA typing using MHC

Terminology –Allele »An alternate form of a gene –Locus »Location of a gene on a chromosome –Gene »Genetic code or “blueprint” for the cell to build one particular protein

DNA DNA is located in the nucleus of the cell Proteins are produced in the cytoplasm of the cell using ribosomes

Protein Synthesis DNA is very large and must be copied in order to enter the cytosol The DNA code is read by the ribosome Amino acids are bonded to make proteins

RNA

DNA contains the Genetic Code RNA is the BLUEPRINT or COPY of the Genetic Code

RNA Differs from DNA RNA has a sugar riboseRNA has a sugar ribose DNA has a sugar deoxyribose

Other Differences RNA contains the base uracil (U)RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single- strandedRNA molecule is single- stranded DNA is double-stranded DNA

. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomesMessenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomesRibosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesizedTransfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized

Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

Ribosomal RNA (rRNA) rRNA is a single strand 100 to 3000 nucleotides longrRNA is a single strand 100 to 3000 nucleotides long Globular in shapeGlobular in shape Made inside the nucleus of a cellMade inside the nucleus of a cell Associates with proteins to form ribosomesAssociates with proteins to form ribosomes Site of protein SynthesisSite of protein Synthesis

Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon

Transfer RNA amino acid attachment site UAC anticodon

Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA

Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase

Pathway to Making a Protein DNAmRNA tRNA (ribosomes) Protein

Transcription and Translation

Transcription During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA

Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop

mRNA Processing After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain

mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5” end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus

39 CAP Tail New Transcript Result of Transcription copyright cmassengale

40 mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes copyright cmassengale

Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins

42 Transcription Translation copyright cmassengale

Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A

Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript

Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG copyright cmassengale

Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids copyright cmassengale

Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon copyright cmassengale

mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation copyright cmassengale

mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

55 End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

Messenger RNA (mRNA) Methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1