Microarrays (Gene Chips) Pioneered by Pat Brown in mid 1990’s To monitor thousands of mRNAs simultaneously Comparative Northern blot on thousands of genes.

Slides:

Advertisements

Similar presentations

Microarray Analysis Allows detection/ comparison of expression levels of multiple genes. What molecule could be used as an indicator of expression?

Advertisements

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.

What if we want to know what allele(s) of beta-globin an individual has?

1 MicroArray -- Data Analysis Cecilia Hansen & Dirk Repsilber Bioinformatics - 10p, October 2001.

Microarray technology and analysis of gene expression data Hillevi Lindroos.

Gene Expression Chapter 9.

Introduction to DNA Microarrays Todd Lowe BME 88a March 11, 2003.

Additional Powerful Molecular Techniques Synthesis of cDNA (complimentary DNA) Polymerase Chain Reaction (PCR) Microarray analysis Link to Gene Therapy.

Genome annotation. What we have GATCAATGATGATAGGAATTGAAAGTGTCTTAATTACAATCCCTGTGCAATTATTAATAACTTTTTTGTT CACCTGTTCCCAGAGGAAACCTCAAGCGGATCTAAAGGAGGTATCTCCTCAAAAGCATCCTCTAATGTCA.

Copyright, ©, 2002, John Wiley & Sons, Inc.,Karp/CELL & MOLECULAR BIOLOGY 3E Transcriptional Control in Eukaryotes Background Information Microarrays.

Parallel human genome analysis: Microarray-based expression monitoring of 1000 genes Mark Schena, Dari Shalon, Renu Heller, Andrew Chai, Patrick O. Brown,

The Human Genome Project and ~ 100 other genome projects:

Microarray Technology Types Normalization Microarray Technology Microarray: –New Technology (first paper: 1995) Allows study of thousands of genes at.

Experimental methods in genome analysis. Genomic sequences are boring GATCAATGATGATAGGAATTGAAAGTGTCTTAATTACAATCCCTGTGCAATTATTAATAACTTTTTTGTT CACCTGTTCCCAGAGGAAACCTCAAGCGGATCTAAAGGAGGTATCTCCTCAAAAGCATCCTCTAATGTCA.

Arrays: Narrower terms include bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, gene arrays, gene.

Inferring the nature of the gene network connectivity Dynamic modeling of gene expression data Neal S. Holter, Amos Maritan, Marek Cieplak, Nina V. Fedoroff,

What are microarrays? Microarrays consist of thousands of oligonucleotides or cDNAs that have been synthesized or spotted onto a solid substrate (nylon,

Introduce to Microarray

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2015 Xiaole Shirley Liu Please Fill Out Student Sign In.

DNA Microarrays Examining Gene Expression. Prof. GrossBiology 4 DNA MicroArrays DNA MicroArrays use hybridization technology to examine gene expression.

Why microarrays in a bioinformatics class? Design of chips Quantitation of signals Integration of the data Extraction of groups of genes with linked expression.

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

Expression Profiling Using DNA MicroArrays - Each cell type within an organism expresses a unique combination of genes – this is, in part, what makes cells.

Exploring the Metabolic and Genetic Control of Gene Expression on a Genomic Scale Joseph L. DeRisi, Vishwanath R. Iyer, Patrick O. Brown Science Vol. 278.

By Moayed al Suleiman Suleiman al borican Ahmad al Ahmadi

Analysis of microarray data

Computational Molecular Biology Biochem 218 – BioMedical Informatics Gene Regulatory.

with an emphasis on DNA microarrays

Lecture 189Functional Genomics Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

CDNA Microarrays Neil Lawrence. Schedule Today: Introduction and Background 18 th AprilIntroduction and Background 25 th AprilcDNA Mircoarrays 2 nd MayNo.

Analyzing your clone 1) FISH 2) “Restriction mapping” 3) Southern analysis : DNA 4) Northern analysis: RNA tells size tells which tissues or conditions.

DNA microarrays Each spot contains a picomole of a DNA ( moles) sequence.

DNA MICROARRAYS WHAT ARE THEY? BEFORE WE ANSWER THAT FIRST TAKE 1 MIN TO WRITE DOWN WHAT YOU KNOW ABOUT GENE EXPRESSION THEN SHARE YOUR THOUGHTS IN GROUPS.

Lecture 22 Introduction to Microarray

Data Type 1: Microarrays

DNA Sequencing 8.2 Image from:

Gene expression and DNA microarrays Old methods. New methods based on genome sequence. –DNA Microarrays Reading assignment - handout –Chapter ,

Applying statistical tests to microarray data. Introduction to filtering Recall- Filtering is the process of deciding which genes in a microarray experiment.

Microarray Technology

Literature reviews revised is due4/11 (Friday) turn in together: revised paper (with bibliography) and peer review and 1st draft.

Genomics I: The Transcriptome

Topic intro slides More complete coverage of components involved in gene expression More information on expression technologies -what would the ideal chip.

MCB 317 Genetics and Genomics Topic 11 Genomics. Readings Genomics: Hartwell Chapter 10 of full textbook; chapter 6 of the abbreviated textbook.

Gene expression. The information encoded in a gene is converted into a protein  The genetic information is made available to the cell Phases of gene.

Sequencing DNA 1. Maxam & Gilbert's method (chemical cleavage) 2. Fred Sanger's method (dideoxy method) 3. AUTOMATED sequencing (dideoxy, using fluorescent.

Lecture 7. Functional Genomics: Gene Expression Profiling using

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Microarray Technology. Introduction Introduction –Microarrays are extremely powerful ways to analyze gene expression. –Using a microarray, it is possible.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

Lecture 18 – Functional Genomics Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

DNA Gene A Transcriptional Control Imprinting Histone Acetylation # of copies of RNA? Post Transcriptional Processing mRNA Stability Translational Control.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Jan. 13, 2011 B4730/5730 Plant Physiological Ecology Introduction to Physiology and Genetics.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Microarrays and Other High-Throughput Methods BMI/CS 576 Colin Dewey Fall 2010.

Gene expression and DNA microarrays No lab on Thursday. No class on Tuesday or Thursday next week –NCBI training Monday and Tuesday –Feb. 5 during class.

Genomes & The Tree of Life

DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.

DNA Sequencing 8.2. Polymerase Chain Reaction (PCR) a direct method of making many copies of a DNA sequence exponential increase because each cycle doubles.

Other uses of DNA microarrays

Engineering magnetosomes to express novel proteins Which ones? Tweaking p18 Linker Deleting or replacing GFP Something else? TRZN Oxalate decarboxylases.

Microarray: An Introduction

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.

Protein Characterization/Purification

The Basics of cDNA Microarray Technology

Introduction to cDNA Microarray Technology

Budding yeast has a small genome of approximately 6000 genes.

Presentation transcript:

Microarrays (Gene Chips) Pioneered by Pat Brown in mid 1990’s To monitor thousands of mRNAs simultaneously Comparative Northern blot on thousands of genes

Two mRNA samples a ‘reference’ and a ‘experimental’

Two mRNA samples a ‘reference’ and a ‘experimental’ For example, yeast cells growing via anaerobic metabolism vs. yeast cells growing via aerobic metabolism

Purify mRNAs from each sample Bind to –TTTTTTTTTT–beads note that you get a population of mRNAs Reverse Transcribe to get a population of cDNAs

“Label” the two mRNA samples differently Reference sample is covalently attached to the fluor Cy3 glows green under UV light

“Label” the two mRNA samples differently Reference sample is covalently attached to the fluor Cy3 glows green under UV light Experimental sample is covalently attached to the fluor Cy5 glows red under UV light

Prepare the Microarray PCR product corresponding to every yeast gene (~6200) Attach to a glass slide at a known location Entire array is 18mm by 18mm (postage stamp)

Prepare the Microarray PCR product corresponding to every yeast gene (~6200) Attach to a glass slide at a known location Entire array is 18mm by 18mm (postage stamp) PFK1 NCC1

Mix reference and experimental cDNAs Add to microarray Using a microscope and a computer, Quantitate ‘greeness’ and ‘redness’ of each spot

DeRisi et al., Science 278:

Consider the NCC Gene if NCC mRNA is equally abundant in reference and experimental population: NCC sequence Spot on Microarray

Consider the NCC Gene if NCC mRNA is equally abundant in reference and experimental population: Spot on Microarray Equal green and red = Yellow

Consider the NCC Gene if NCC mRNA is more abundant in reference than experimental population (repressed by aerobic growth): Spot on Microarray Spot glows green

Consider the NCC Gene if NCC mRNA is less abundant in reference than experimental population (induced by aerobic growth): Spot on Microarray Spot glows red

Microarrays: Compare amounts of several thousand mRNAs Red, Green, Yellow or Black Between two conditions, experimental and reference looking for induction or repression

Following the timecourse: These seven genes all encode proteins in the electron transport chain.

Following the timecourse: These seven genes all encode proteins in the electron transport chain. These seven genes all contain the same enhancer sequence: CCAAT Binds the transcription factor Hap2/3/4p