Knowledgebase Creation & Systems Biology: A new prospect in discovery informatics S.Shriram, Siri Technologies (Cytogenomics), Bangalore S.Shriram, Siri.

Slides:



Advertisements
Similar presentations
The Drug Discovery Process
Advertisements

Unravelling the biochemical reaction kinetics from time-series data Santiago Schnell Indiana University School of Informatics and Biocomplexity Institute.
13:10:58 A New Tool for Mapping Microarray Data onto the Gene Ontology Structure ( Abstract e GOn (explore Gene Ontology) is a.
Biological pathway and systems analysis An introduction.
MitoInteractome : Mitochondrial Protein Interactome Database Rohit Reja Korean Bioinformation Center, Daejeon, Korea.
Oncomine Database Lauren Smalls-Mantey Georgia Institute of Technology June 19, 2006 Note: This presentation contains animation.
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
16 November 2004Biomedical Imaging BMEN Biomedical Imaging of the Future Alvin T. Yeh Department of Biomedical Engineering Texas A&M University.
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Systems Biology Existing and future genome sequencing projects and the follow-on structural and functional analysis of complete genomes will produce an.
Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
August 29, 2002InforMax Confidential1 Vector PathBlazer Product Overview.
Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.
OMICS Group Contact us at: OMICS Group International through its Open Access Initiative is committed to make genuine and.
Proteomics Understanding Proteins in the Postgenomic Era.
DEMO CSE fall. What is GeneMANIA GeneMANIA finds other genes that are related to a set of input genes, using a very large set of functional.
Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.
Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore A Tutorial on Bioinformatics.
Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.
1 The Discovery Informatics Framework Pat Rougeau President and CEO MDL Information Systems, Inc. Delivering the Integration Promise American Chemical.
Evolva Biotech SA Microarray and Macro opportunities for Discovery informatics Head of Informatics Mobile.
Formal Empirical Applied Mathematical and technical methods and theories Cognitive, behavioral, and organizational techniques and theories ImagingBioInformaticsClinical.
Ch10. Intermolecular Interactions and Biological Pathways
Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.
Development of Bioinformatics and its application on Biotechnology
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Information Systems Basic Core Specialization Clinical Imaging BioInformatics Public Health Computer Science Methods (formal models) Biomedical Decision.
Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-
InsilicoCell: an integrated platform for biological model development and analysis Thai Quang Tung Korea Institute of Science and Technology Information.
Introduction to Pharmacoinformatics
GTL Facilities Computing Infrastructure for 21 st Century Systems Biology Ed Uberbacher ORNL & Mike Colvin LLNL.
Bioinformatics Dr. Víctor Treviño BT4007
A New Oklahoma Bioinformatics Company. Microarray and Bioinformatics.
Affymetrix/BioCarta comparison & Java-based pathway analysis Michael Edmonson 2/26/2003.
Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.
Computational biology of cancer cell pathways Modelling of cancer cell function and response to therapy.
NIH Council of Councils Meeting November 21, 2008 LINCS Library of Integrated Network-based Cellular Signatures.
Agent-based methods for translational cancer multilevel modelling Sylvia Nagl PhD Cancer Systems Science & Biomedical Informatics UCL Cancer Institute.
Bioinformatics Core Facility Guglielmo Roma January 2011.
Systems Biology ___ Toward System-level Understanding of Biological Systems Hou-Haifeng.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:
Decoding the Network Footprint of Diseases With increasing availability of data, there is significant activity directed towards correlating genomic, proteomic,
Biological systems and pathway analysis
Information Technology in the Natural Sciences Biology – Chemistry – Physics.
Pathway: a collection of genes, proteins, and /or small molecules that modulate a cellular process or disease state Growing demand in biological sciences.
By: Amira Djebbari and John Quackenbush BMC Systems Biology 2008, 2: 57 Presented by: Garron Wright April 20, 2009 CSCE 582.
An overview of Bioinformatics. Cell and Central Dogma.
Bioinformatics and Computational Biology
Affymetrix microarray analysis by using Cmap By NFU Biology Algorithm lab.
1 Bioinformatics at Norwegian University of Science and Technology Professor Finn Drabløs Department of Cancer Research and Molecular Medicine Finn Drabløs.
Nonlinear differential equation model for quantification of transcriptional regulation applied to microarray data of Saccharomyces cerevisiae Vu, T. T.,
Modeling and Simulation of Signal Transduction Pathways Mark Moeller & Björn Oleson Supervisors: Klaus Prank Ralf Hofestädt.
MDL Information Systems, Inc. Powering the Process of Invention Donna del Rey Director, Business Planning
Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.
High throughput biology data management and data intensive computing drivers George Michaels.
Introduction to Oncomine Xiayu Stacy Huang. Oncomine is a cancer-specific microarray database and has a web-based data-mining platform aimed at facilitating.
1 Survey of Biodata Analysis from a Data Mining Perspective Peter Bajcsy Jiawei Han Lei Liu Jiong Yang.
University of Pavia Dep. of Electrical, Computer and Biomedical Engineering Laboratory of Bioinformatics, Mathematical Modelling and Synthetic Biology.
Molecular Modeling in Drug Discovery: an Overview
Show & Tell Limsoon Wong Kent Ridge Digital Labs Singapore Role of Bioinformatics in the Genomic Era.
Page 1 Computer-aided Drug Design —Profacgen. Page 2 The most fundamental goal in the drug design process is to determine whether a given compound will.
BME435 BIOINFORMATICS.
Dr. George Geromichalos, Ph.D.
APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY
Virtual Screening.
PREDICT.
Drug Design and Drug Discovery
Presentation transcript:

Knowledgebase Creation & Systems Biology: A new prospect in discovery informatics S.Shriram, Siri Technologies (Cytogenomics), Bangalore S.Shriram, Siri Technologies (Cytogenomics), Bangalore

A knowledgebase provides an integrated approach to biological simulation that combines process, technology, tools and applications for solving complex problems and for data representation, validation and prediction What is a knowledgebase?

The use of simulation in pharmaceutical research enables investigators to anticipate potential issues in the drug discovery process and to select the best overall design principles in advance of real-life studies Knowledgebases forms the base for SYSTEM BIOLOGY - ie study of biological systems using a holistic approach

Access proprietary and public databases, data analysis tools, and computer algorithms within a single, expandable, web-based software environment Streamline data analysis and interpretation Share experimental data and models across organizational networks Advantages of Knowledgebase

Advantages…. Explore new experimental scenarios, test hypotheses, and generate predictive information Create, run, modify and routinely upgrade detailed models of cells, tissues and organs with little or no dependence on highly trained programmers

Path to Knowledgebase Knowledgebase Database Infobase

Identify the disease and tissue (eg. pancreatic cancer and pancreas and other related tissues) Data to be gathered form curation of literature, experiments(eg. gene expression studies), clinical studies and analysis/interpretation of these details to extract information (eg. identify targets/side effects of known drugs in the pathways) Creation of Knowledgebase

Creation… Represent complex experimental data in mathematical form and then uses these equations to build customized biological models Models to aid prediction of effects of new drugs, etc.

Drug Discovery –Emerging needs for Knowledgebase Chemo-informatics Curated Knowledgebase Target identification Target evaluation and selection Lead identification/o ptimization Process development Preclinical evaluation Clinical evaluation Bioinformatics Drug

Types of Knowledgebase Ligands/ Drugs Gene/Protein/Target Pathways

Integrated Platform for Bio and Chemo Knowledgebase Patent & Published Literature Proprietary Data BioinformaticsChemoinformatics Integrated Knowledgebase

Ligand centric knowledgebase Pharmacophore models Combinatorial chemistry Ligand Centric Structure 2D, 3D Drug Targets Target Sequence Target Structure (3D) Patents & literature Synthesis Assay / Bioactivity SAR Physico-chemical properties Ligand – target interaction Regulatory information ADME and Toxicity Analogs

Data Integration Integrated Database Homologene LocusLink SWISS-PROT Homologous GenBank BODYMAP Probeset UniGene OMIM

Features of pathway database Clickable maps that give data on the proteins of interest Multiple search modes, including protein, signaling molecule and ligand structure based searches and other filters like physiology, organism, disease state etc Provision for a comprehensive account of the diseases, to enable the user to build and visualize non-canonical pathways

Caspase Pathway

Features of Pathway Knowledgebase Tagging of gene expression data (from Microarray, SAGE, etc) onto the simple clickable pathway maps. In-silico manipulation of pathways – ie predict the alterations in expression levels in any given tissue or disease conditions Ease target prioritization

Building blocks of SYSTEM BIOLOGY Ligands/ Drugs Gene/Protein/Target Pathways Organism / disease Cell / tissue

Why we need biological systems?  To figure out  What is the effect of an intervention in one part of the system, and its associated problem?  What intervention one has to make in order to obtain some desired result? Key Players  Physiome Sciences  Entelos Inc.

Predictive biology GeneChips High-ThroughputSystems Knock-outs HealthcareAlliances Bioinformatics Predictive Biological ModelsFragmentedExpertise IntegratedKnowledge Computer Simulation Novel InsightsClinicalResponse MolecularTarget

ExampleExample Since these equations are completely defined by the knowledge of connectivity of a network, and knowledge of various transition rate constants, and since these quantities are all stored in a databases, the equations may be generated automatically on a computer

Allen resident cell activation inflammatory cell influx Bill resident cell activation inflammatory cell influx 8% improvement in FEV121% improvement in FEV1

Applications of Systems Biology Understanding disease dynamics Understanding disease dynamics Test hypotheses of a disease pathology Test hypotheses of a disease pathology – Ask better questions – Plan better experiments Identify and fill the knowledge gaps Identify and fill the knowledge gaps Bridging biochemistry to clinical outcomes Bridging biochemistry to clinical outcomes Target assessment & prioritization Target assessment & prioritization Drug candidate advancement Drug candidate advancement Combination therapy assessment Combination therapy assessment Designing and understanding clinical studies Designing and understanding clinical studies Patient selection and dosing Patient selection and dosing Surrogate marker prediction Surrogate marker prediction

Entelos demo

Thanks to Siri Technologies Cytogenomics Jubilant Biosys Entelos Physiome Sciences

Thank you