Goal 3.01b: Protein Synthesis and Gene Regulation

From Gene to Protein Central Dogma

 Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA

What makes it possible for different people… … to have different faces? i.ivillage.com symonsez.files.wordpress.com …to be different heights? neveryetmelted.com …to have different colored eyes?

Makes this protein… or this protein… or this protein! Each DNA makes a specific protein. Those proteins give us our looks. cr4.globalspec.com gamespot.com

Remember…  Bases match together  A pairs with T  A : T  C pairs with G  C : G  weak bonds between bases join 2 strands  can separate easily Now it is time to find out how DNA manages to create so many different kinds of organisms using only FIVE pieces of information!

What do we know?  DNA  DNA is the genetic information  Proteins  proteins run living organisms  enzymes  all chemical reactions in living organisms are controlled by enzymes (proteins)  structure  all living organisms are built out of proteins  DNA is the instructions for making proteins

What else do we know?  DNA  DNA is in the nucleus  want to keep it there = protected  Proteins  made by a “protein factory” in cytoplasm  ribosomes  Need to get gene (DNA) information from nucleus to cytoplasm  need a messenger!  need a copy of DNA  mRNA

deoxyribose sugar nitrogen bases – G, C, A, T T = thymine – T : A – C : G double stranded ribose sugar nitrogen bases – G, C, A, U U = uracil – U : A – C : G single stranded D NA R NA

mRNADNA transcription nucleus cytoplasm protein translation trait A brief overview of what happens…

DNA (double helix) is too big to go through the pores in the nuclear envelope. The problem with DNA… RNA (single helix) is small. DNA gives its information to mRNA (messenger RNA) to carry out of the nucleus. TOO BIG! Just right.

Making mRNA from DNA DNA strand is the template (pattern) – match bases U : A G : C Enzyme – RNA polymerase mRNA TRANSCRIPTION

Making mRNA from DNA AGGGGGGTTACACTTTTTCCCCAA TRANSCRIPTION AGGGGGGTTACACTTTTTCCCCAA U U UU U

Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA TRANSCRIPTION

Use RNA polymerase Match free floating RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A TRANSCRIPTION Free-floating nucleotides

DNA mRNA TRANSCRIPTION TACGCATTTACGTAGCGG lIIIIIIIIIIIIIIIII AUGCGUAAAUGCAUCGCC Transcription Animation U instead of T is matched to A We are transcribing DNA into RNA.

What do we know NOW?  DNA  instructions remain in nucleus  mRNA  has the instructions for building proteins from DNA  Proteins  built as chains of amino acids  What reads RNA?  need a mRNA reader!  rRNA in ribosomes a a a aaa a UCCCCCCAAUGUGAAAAAGGGGUU

cytoplasm aa mRNA From gene to protein DNA nucleus Protein Trait UCCCCCCAAUGUGAAAAAGGGGUU rRNA ribosome mRNA leaves nucleus through nuclear pores rRNA inside the ribosomes synthesize amino acids to make a protein using instructions on mRNA Transcription CELL aa Translation

 mRNA  has the instructions for building proteins from DNA  Proteins  built as chains of amino acids linked by peptide bonds  What reads mRNA?  ribosome  What brings the right amino acid to attach to the protein chain?  need an amino acid transporter!  tRNA a a a aaa a What do we ALSO know now? UCCCCCCAAUGUGAAAAAGGGGUU ribosome Peptide bonds

mRNA From gene to protein DNA nucleus Protein Trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome Transcription cytoplasm CELL aa Translation aa tRNA tRNA carries the correct amino acid (based on the mRNAcode) to the ribosome.

Protein Synthesis Let’s build a flow chart! TRANSCRIPTION DNA gives mRNA blueprints for making a specific protein. mRNA carries the blueprints out of the nucleus to the cytoplasm and finds a ribosome. TRANSLATION rRNA reads the mRNA inside the ribosome.

tRNA brings the correct amino acid to the mRNA. An amino acid chain is built: PROTEIN. Protein give us our traits. BUILD DNA AND DISCOVER GENES! 1. What is DNA? 2. What is a Gene? 3. Build a DNA Molecule.

How does tRNA know which amino acid to bring? When mRNA leaves nucleus it has a blueprint of DNA’s instructions. mRNA goes to ribosomes in cytoplasm Ribosomes read the blueprint on mRNA. aa mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

Using the template… TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

AUGCGUGUAAAUGCAUGCGCC mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala Amino acid ? ribosome Codon = set of 3 bases Anticodon = set of 3 bases UAC

The code is UNIVERSAL! Since all living organisms… – use the same DNA – use the same code book – read their genes the same way AUG

What amino acids are coded for by these codons? UGA ACU AAC GAG

For ALL life! – Uses only 4 bases for ALL life. (strongest support for a common origin for all life) Code is redundant – several codons for each amino acid – mutation insurance! The mRNA code  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG

TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA tRNA Pro Ala Met Val Leu tRNA Met Transcription and Translation Builder tRNA Arg tRNA Arg

You Transcribe and Translate a Gene! Step Through Translation 1. Transcribe and Translate a Gene 2. What makes a firefly glow? DNA Translation Real Time and Interactive Transcription in Real Time (view as class)

Can you tell the story? DNA transcription ribosome tRNA amino acids protein translation mRNA 29:08 Central Dogma Biologix__Translation_and_Protein_Synthesis A Quick Review…. 1. What is this molecule? 3.What is this process? 2.What is this molecule? 4.What is this structure? 8.What is this process? 6.What are these molecules? 5.What is this molecule? 7.What is this molecule?

DNATAC GCA TGG AAT  TAC GCA TGG AAT Substitution/Point Mutation = one base is changed and one amino acid is changed. mRNA AUG CGU ACC UUA  AUG CAU ACC UUA Protein Met Arg Thr Leu  Met His Thr Leu DNATAC GCA TGG AAT  TAC GTA TGG AAT Insertion Mutation = one base is inserted and everything downstream is changed. mRNA AUG CGU ACC UUA  AUA GCA UAC CUU A Protein Met Arg Thr Leu  Ile Ala Tyr Leu T DNATAC GCA TGG AAT  TAT CGT ATG GAA T

EXPLAIN DIVERSITY… Each organism has a unique sequence of DNA. The DNA sequence determines the order of amino acids in the organism’s proteins. The order of amino acids determines the shape that the protein made will take. The shape of the protein determines what it can do. What the protein does determines everything about the organism. Gene Regulation determines when a sequence of DNA will be put to use and when it won’t.

Gene Regulation…Keeping Control! Every species has its own number of chromosomes in each cell. Organism Number of Chromosomes Cat32 Chimpanzee48 Dog78 Cow60 Human46 Horse64 Pea plant14 Corn plant20 Mosquito6 Honeybee32 Sugarcane80 Sand dollar62 Notice: More is not always better... Sometimes it’s just more.

Remember…a section on a chromosome that codes for a specific trait is called a GENE. And… There are lots and lots of genes on each chromosome! The job of a gene is to control the production of proteins.

Not every gene is expressed (turned on) at the same time. Gene Regulation = what controls when a gene is expressed and when it is not. In bacteria, genes are in groups called Operons. Example: E. coli that’s in our digestive system helps us break down milk. Each Operon codes for a specific protein. Baby features (birth – 5 yrs) Child features (5 yrs – 12 yrs) Teen features (12 yrs – 17 yrs) Adult features (17 yrs – 60 yrs) Elderly features (60 yrs – death)

RNA polymerase Promoter Sequence = area “upstream” (toward the 5’ end) from the gene where the RNA polymerase attaches. Start Codon = set of three nucleotide bases where transcription begins. Stop Codon = set of three nucleotide bases where transcription ends. Terminator Sequence = area “downstream” from the gene where the polymerase detaches. Gene 5’ 3’

Lac operon Are You Lactose Intolerant? Here’s how we metabolize milk… Has to have a CAP to start. Can NOT have a Repressor. /webcontent/animation s/content/lacoperon.ht ml

Beadle and Tatum One gene, one protein. Beadle and Tatum Experiment

Gene Therapy: Introduction What is Gene Therapy? Using parts of a gene from a healthy cell to fix a damaged or sick cell. How Gene Therapy Works (Interactive) anet/comsoc/Lab_bio/sim ulacions/GeneTherapy/Ge neTherapy.htm

Don’t hate me because I’m beautiful… Blame it on my GENES! Any Questions? img1.chakpak.com Assignment: Coach Book L15