The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation Viruses: Genes in Small Packages

Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes A segment of DNA (gene) carries specific coded instructions for the making of a single proteins. Genotype: The genes carried in a cell for a particular trait Phenotype: The physical expression of genes for a particular trait

Transcription: From DNA to RNA In transcription, –Genetic information is transferred from DNA to RNA. –An RNA molecule is transcribed from a DNA template. Transcription

Figure In Eukaryotes, the mRNA is Edited Before Leaving the Nucleus

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation and Mutagens Viruses: Genes in Small Packages

= 3 Types of RNA – Each With a Different Job Messenger RNA (mRNA) Carries copy of gene information to the ribosome to make protein anticodon Ribosomal RNA (rRNA) Part of the structure of the ribosome; key component in amino acid linking machinery CUG Transfer RNA (tRNA) Carries amino acids to the ribosome for linking; identified by anticodon “sign”

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation and Mutagens Viruses: Genes in Small Packages

Figure Anatomy of a Messenger RNA Leader Trailer

How Gene Instructions are Communicated

mRNA Codon Dictionary of the Genetic Code

DNA template strand: CGTTTACGACCGGCCTTAGATCCTGACG Central Dogma: DNA  RNA  Protein mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC Transcription by RNA polymerase Translation by ribosome Protein: Met -Leu -Ala -Gly -Ile

Figure 10.16a

Figure 10.16b

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation and Mutagens Viruses: Genes in Small Packages

Translation: The Process Translation is divided into three phases: –Initiation –Elongation –Termination

Translation: Initiation Events of Initiation 1.The messenger RNA binds to the small ribosomal subunit 2.The two subunits of the ribosome come together 3.The first amino acid with its attached tRNA

Translation: Elongation Events of Elongation –1. The anticodon of an incoming tRNA pairs with the mRNA codon. 2. The ribosome catalyzes a peptide bond to form between amino acids 3. A tRNA leaves the P site of the ribosome 4. The ribosome moves down the mRNA (translocation)

Translation: Termination Events of Termination 1.Elongation continues until the ribosome reaches a stop codon. 2.The two subunits of the ribosome separate 3.The mRNA is released to be used again 4.The finished polypeptide (protein) folds up and begins functioning

Figure 10.10

Review: DNA  RNA  Protein The flow of genetic information in a cell

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation Viruses: Genes in Small Packages

Mutations A mutation –Is any change in the nucleotide sequence of DNA –Is a permanent, heritable change Mutations may result from –Errors in DNA replication. –Physical or chemical agents called mutagens. Although mutations are usually lethal, –They are the source of the rich diversity of genes in the living world. –They contribute to the process of evolution by natural selection.

Figure Base Substitution (Point Mutation) DNA base substitutions can cause: missense, run-on, nonsense, and silent mutations in the resultant protein

Figure 10.22b Insertions or Deletions of DNA nucleotides Insertion/Deletions cause frameshift mutations in the protein (and often run-on mutations too)

Types of Mutation

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation and Mutagens Viruses: Genes in Small Packages

Viruses: Genes in Packages Properties of Viruses –They exhibit some, but not all, characteristics of living organisms –They are made of DNA or RNA surrounded by a protein coating. Some also have envelopes outside their protein coat –They are incredibly small (< 1 um) –They are obligate intracellular parasites –They they can only attack a small range of cell types (host specificity)

Viruses Come in Many Shapes Helical Polyhedral Enveloped Complex

Figure Bacterial Viruses Can Either Reproduce Immediately or Hide Within The Host Cell and Emerge When the Host is Dying

Animal Viruses Often Have a Membranous Envelope with Protein Spikes The influenza virus carries specific “spikes” that make them infective Spikes are classified by Hemagglutinin (H) and Neuraminidase (N) types e.g. H1N1

Figure Simplified Viral Reproductive Cycle Animal Virus Lifecycle

HIV, the AIDS Virus HIV is a retrovirus. –A retrovirus is an RNA virus that reproduces by means of a DNA molecule. –It copies its RNA to DNA using reverse transcriptase. HIV Reproductive Cycle

Figure 10.30b How Human Immunodeficiency Virus Attacks T White Blood Cells

The Structure and Function of DNA CHAPTER 10 Transcription (DNA  RNA) RNA Polymerase Processing of Eukaryotic RNA Translation (mRNA  Protein) The Three Types of RNA Codons and the Genetic Code Ribosomes Steps of Translation Mutation Viruses: Genes in Small Packages