© 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition – Eric Simon, Jane Reece, and Jean Dickey Campbell Essential Biology with Physiology, Third Edition – Eric Simon, Jane Reece, and Jean Dickey CHAPTER 12 DNA Technology

© 2010 Pearson Education, Inc. Stem Cells

© 2010 Pearson Education, Inc. Adult stem cells in bone marrow Cultured embryonic stem cells Different culture conditions Different types of differentiated cells Heart muscle cells Nerve cells Blood cells Figure 11.15

© 2010 Pearson Education, Inc. Umbilical Cord Blood Banking  Umbilical cord blood Can be collected at birth Contains partially differentiated stem cells Limited use

Figure 12.1

© 2010 Pearson Education, Inc. Recombinant DNA Techniques Bacteria are the workhorses of modern biotechnology. In the lab, biologists use bacterial plasmids (small, circular DNA molecules) that are separate from the much larger bacterial chromosome. Can easily pick up foreign DNA Are taken up by bacterial cells; called transformation Act as vectors (DNA carriers that move genes from one cell to another)  Recombinant DNA help biologists produce large quantities of a desired protein.

Plasmids Bacterial chromosome Remnant of bacterium Colorized TEM Figure 12.7

Plasmid Bacterial cell Isolate plasmids. Some uses of genes Gene for pest resistance Gene for toxic-cleanup bacteria Genes may be inserted into other organisms. Find the clone with the gene of interest. The gene and protein of interest are isolated from the bacteria. Clone the bacteria. Recombinant bacteria Bacterial clone Gene of interest Recombinant DNA plasmids Bacteria take up recombinant plasmids. Harvested proteins may be used directly. Some uses of proteins Protein for “stone-washing” jeans DNA Cell containing the gene of interest Protein for dissolving clots Isolate DNA. DNA fragments from cell Cut both DNAs with same enzyme. Gene of interest Other genes Mix the DNAs and join them together. Figure

A Closer Look: Cutting and Pasting DNA with Restriction Enzymes  Recombinant DNA is produced by combining two ingredients: A bacterial plasmid The gene of interest  To combine these ingredients, a piece of DNA must be spliced into a plasmid.  This splicing process can be accomplished by: Using restriction enzymes, which cut DNA at specific nucleotide sequences © 2010 Pearson Education, Inc.

Restriction enzymes  Bacterial enzymes that recognize and cut DNA at specific sequences  What is there use naturally in bacteria?  Are very specific  Usually recognize sequences 4-8 nucleotides long  Sequences recognized are palindromes  Example: EcoR1 recognizes GAATTC and cuts always between the G and A

© 2010 Pearson Education, Inc. Producing pieces of DNA called restriction fragments with “sticky ends” important for joining DNA from different sources – DNA ligase connects the DNA pieces into continuous strands by forming bonds between adjacent nucleotides.

Recognition sequence for a restriction enzyme Restriction enzyme Sticky end Sticky end DNA A restriction enzyme cuts the DNA into fragments. Figure

Recognition sequence for a restriction enzyme Restriction enzyme Sticky end Sticky end DNA A DNA fragment is added from another source. A restriction enzyme cuts the DNA into fragments. Figure

Recognition sequence for a restriction enzyme Restriction enzyme Sticky end Sticky end DNA A DNA fragment is added from another source. A restriction enzyme cuts the DNA into fragments. Fragments stick together by base pairing. Figure

Recognition sequence for a restriction enzyme Restriction enzyme Sticky end Sticky end DNA ligase Recombinant DNA molecule A DNA fragment is added from another source. A restriction enzyme cuts the DNA into fragments. Fragments stick together by base pairing. DNA ligase joins the fragments into strands. Figure

© 2010 Pearson Education, Inc. Genetic engineering vocab  Recombinant DNA- nucleotide sequences from two different sources to form a single DNA molecule.  genetic engineering, the direct manipulation of DNA for practical purposes.  Biotechnology – use of organisms or their components to make useful products  Transgenic organism – contains a gene from another organism, typically a different species  Genetically modified organisms (GMOs)- organisms that have acquired one or more genes by artificial means.

Plasmid Bacterial cell Isolate plasmids. Some uses of genes Gene for pest resistance Gene for toxic-cleanup bacteria Genes may be inserted into other organisms. Find the clone with the gene of interest. The gene and protein of interest are isolated from the bacteria. Clone the bacteria. Recombinant bacteria Bacterial clone Gene of interest Recombinant DNA plasmids Bacteria take up recombinant plasmids. Harvested proteins may be used directly. Some uses of proteins Protein for “stone-washing” jeans DNA Cell containing the gene of interest Protein for dissolving clots Isolate DNA. DNA fragments from cell Cut both DNAs with same enzyme. Gene of interest Other genes Mix the DNAs and join them together. Figure

© 2010 Pearson Education, Inc.  How do these cats show examples of genetic engineering, transgenic organisms and recombinant DNA? Warm up December 17

© 2010 Pearson Education, Inc. Human Cell Gene for human growth hormone Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone

© 2010 Pearson Education, Inc. Making Humulin - 1 st engineered product

© 2010 Pearson Education, Inc. Genetically Modified (GM) Foods

© 2010 Pearson Education, Inc.  “Golden rice”

© 2010 Pearson Education, Inc. DNA PROFILING AND FORENSIC SCIENCE  DNA profiling (fingerprinting): Used to determine if two samples of genetic material are from same person Scientific crime scene analysis  To produce a DNA profile Scientists compare genetic markers Sequences in the genome that vary from person to person.

© 2010 Pearson Education, Inc. Investigating Murder, Paternity, and Ancient DNA  DNA profiling can be used to: Test the guilt of suspected criminals Identify tissue samples of victims Resolve paternity cases Identify contraband animal products Trace the evolutionary history of organisms

DNA isolated DNA amplified DNA compared Crime scene Suspect 1Suspect 2 Figure

DNA Profiling Techniques The Polymerase Chain Reaction (PCR)  The polymerase chain reaction (PCR): Is a technique to copy quickly and precisely any segment of DNA Can generate enough DNA, from even minute amounts of blood or other tissue, to allow DNA profiling © 2010 Pearson Education, Inc. How do you test if two samples of DNA come from the same person?

© 2010 Pearson Education, Inc. Gel Electrophoresis Compares the lengths of varied DNA fragments Uses gel electrophoresis, a method for sorting macromolecules—usually proteins or nucleic acids—primarily by their Electrical charge Size

Mixture of DNA fragments of different sizes Power source Gel Completed gel Band of longest (slowest) fragments Band of shortest (fastest) fragments Shorter fragments travel through the gel faster than longer fragments Fragments travel to positive end because phosphates in DNA are negatively charged 2 ways to analyze DNA in gel electrophoresis

© 2010 Pearson Education, Inc. Short Tandem Repeat (STR) Analysis  Short Tandem Repeats (STR’s) Short repetitions (usually 4 nucleotides) Number of repeats can vary from person to person Used in DNA profiling/criminal investigations FBI uses 13 repetitive sites on our DNA

Crime scene DNA Suspect’s DNA Same number of short tandem repeats Different numbers of short tandem repeats STR site 1STR site 2 AGAT GATA Figure 12.16

Amplified crime scene DNA Amplified suspect’s DNA Longer fragments Shorter fragments Figure 12.18

© 2010 Pearson Education, Inc. RFLP Analysis  Before placed in the gel, DNA is mixed and cut by restriction enzymes Individuals have unique restriction sites so DNA fragment lengths may vary Used often to compare different gene alleles Basis of some genetic and paternity tests

© 2010 Pearson Education, Inc. RFLP AATTCTAGTACCTA GATCATGGAT GAATTC CTTAAG EcoRI ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA TACGAATTCCGCATGTGACCTTAAGATCATGGT T ATGCTTAAGGCGTACACTG TACGAATTCCGCATGTGACTTAA ATGCTTAAGGCGTACACTGAATTCTAGTACCTA TACGAATTCCGCATGTGACTTAAGATCATGGAT ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA TACGAATTCCGCATGTGACCTTAAGATCATGGT T Region cut into 2 fragments by EcoRI Region not cut by EcoRI due to base substitution at restriction site.

Crime scene DNA Suspect’s DNA Fragment w Fragment x Fragment y Longer fragments Shorter fragments Fragment z Fragment y Crime scene DNA Suspect’s DNA Cut Restriction enzymes added x w y y z Figure 12.19

© 2010 Pearson Education, Inc. Lane 2 is mom, lane 5 is son so…who’s the daddy? 3 or 4?

© 2010 Pearson Education, Inc. For the test 1. Cloning 1. What is it? 2. Reproductive vs. therapeutic cloning 3. How to do reproductive cloning (how did you clone mimi the mouse) 2. Stem cells 1. What are they? 2. Types of stem cells and their potential 3. Where do we find different types of stem cells such as adult, embryonic 4. What are IPS stem cells and why are they important? 3. Recombinant DNA 1. What is it? 2. How do we make a recombinant plasmid? 3. What is it used for?

© 2010 Pearson Education, Inc. For the test 4. PCR/gel electrophoresis 4. What are they used for? 5. How is a gel electrophoresis run? 6. How is a gel electrophoresis read? 5. Human genome project/Gene therapy 4. What are they? 5. For what do they hope to use these?

Table 12.1

© 2010 Pearson Education, Inc. The Human Genome Project  Begun in 1990, the Human Genome Project was a massive scientific endeavor: To determine the nucleotide sequence of all the DNA in the human genome and To identify the location and sequence of every gene

© 2010 Pearson Education, Inc. HUMAN GENE THERAPY  Human gene therapy: Is a recombinant DNA procedure Seeks to treat disease by altering the genes of the afflicted person Often replaces or supplements the mutant version of a gene with a properly functioning one

Normal human gene isolated and cloned Healthy person Figure

Normal human gene isolated and cloned Normal human gene inserted into virus Healthy person Harmless virus (vector) Virus containing normal human gene Figure

Normal human gene isolated and cloned Normal human gene inserted into virus Virus injected into patient with abnormal gene Healthy person Harmless virus (vector) Virus containing normal human gene Bone marrow Bone of person with disease Figure

© 2010 Pearson Education, Inc. SCID – severe combined immune deficiency  SCID is a fatal inherited disease caused by a single defective gene that prevents the development of the immune system.  SCID patients quickly die unless treated with: A bone marrow transplant or Gene therapy

© 2010 Pearson Education, Inc. SCID and gene therapy  Since the year 2000, gene therapy has: Cured 22 children with inborn SCID but Unfortunately, caused four of the patients to develop leukemia, killing one of these children