Objective: You will be able to list the positives and negatives of genetic engineering Do Now: Read “Increasing variation” which starts on p. 320 and ends on page 321 Give one example of a new bacteria that was reproduced Give one example of a new plant that was reproduced
Genetic Engineering This is a new technology used to change the genetic instructions in individuals
Why would you want to change the genetic instructions in an organism? To allow the organism to do something new –Ex. Insert a gene into crops to allow them to make a protein to fight of a fungus For gene therapy –A defective gene is replaced with a “good” gene
Objective: You will be able to describe how DNA is removed from one cell and added to another cell. Do Now: Read all of p. 327 Define transformation What is a plasmid?
1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCT ACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Section 13-2 Interest Grabber continued
Recognition sequences Section 13-2 Restriction Enzymes Recognition sequences are the places on the DNA where an enzyme will cut it
Recognition sequences Sticky end Section 13-2 Restriction Enzymes
Human Cell Gene for human growth hormone Recombinant DNA Gene for human growth hormone Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone Section 13-3 Figure 13-9 Making Recombinant DNA
Mixed DNA When you combine DNA from two individuals, we call it recombinant DNA
Figure 17.5 A tobacco plant expressing a firefly gene
Objective: You will be able to explain how gel electrophoresis separates pieces of DNA. Read the section named “The tools of molecular Biology” on p How is DNA cut? How is DNA separated?
Use of Restriction Enzymes Restriction enzymes cut DNA whenever they see a specific sequence of bases. The pieces of cut DNA are called restriction fragments Each person has a different DNA sequence So restriction enzymes will cut each person’s DNA into different sized pieces.
We can use a process called gel electrophoresis to separate the pieces
Figure 20.x1a Laboratory worker reviewing DNA band pattern
Gel Electrophoresis Moves DNA because it is negative Separates DNA fragments based on size The smaller the fragment the farther it will move Can compare DNA from individuals
Figure DNA fingerprints from a murder case
Figure 20.9 Using restriction fragment patterns to distinguish DNA from different alleles
Objective: You will be able to explain how selective breeding can be used to improve offspring. Do Now Read all of page 310 Define selective breeding Define hybridization
The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Interest Grabber
Labrador retriever
Poodle
Labradoodles?
Goldendoodle?
Can you think of some selective breeding examples
Objective: You will be able to describe the process of cloning. How can a sheep that is 12 years old have a twin that is 4 years old?
Cloning Section 13-4 Flowchart A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The fused cell begins dividing, becoming an embryo. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.
A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Section 13-4