Cloning Guanqun Yuan R.A.Scott Group Meeting

Outline  What is cloning?  How to do cloning?  Validation  Application

What is Cloning? Generating identical copies of organisms, cells, or replicating nucleic acid sequences from organisms involving human intervention. Giving rise to new generation Dolly (the sheep) is a clone, but a natural identical twin is not a clone. DNA sequence amplified by growth is a clone, Identical DNA molecules produced in vitro (a PCR rxn) is not a clone.

Outline  What is cloning?  How to do cloning?  Validation  Application

Plasmid vector + DNA fragment to be cloned Enzymatically insert DNA into plasmid vector Recombinant plasmid Mix E.coli cells with plasmids in presence of CaCl 2 Culture on nutrient agar plates containing ampicillin Cells that do not take up plasmids die on ampicillin plates Transformed E.coli cell survives Bacterial chromosome Independent plasmid replication Cell multiplication How? Amp R. ORI

Composition Vectors Plasmids, or phage The cell E.coli, yeast Inserted sequence Plasmid vector DNA fragment to be cloned

Vectors The substance that can serve as carriers to allow replication of recombinant DNAs. Plasmids Phage λ Plasmid phage hybrids

Plasmids ds circles of DNA that can replicate autonomously. Three features of the plasmid cloning vectors: Multiple cloning site. The place where foreign DNA fragments can be inserted. An origin of replication. The replication origin is a specific DNA sequence of base pairs that must be present in a plasmid for it to replicate. Host-cell enzymes bind to ORI, initiating replication of the circular DNA. A gene specifying resistance to an Antibiotic. This permits selective growth of the host cell. Most often used: Resistance to ampicillin, penicillin, tetracycline, kanamycin, and chloramphenicol. MCS Ab. Resis ORI

Phage λ A phage λ virion has a head, which contains the viral DNA genome, and a tail, which functions in infecting E.coli host cells. Advantages over plasmids: They infects cells much more efficiently than plasmids transform cells. The yield of clones with vectors usually higher. Because of its efficiency, phage λ is often used in library construction. Viral Genome

The Cell E.coli: Normal E. coli cells cannot take up plasmid DNA from the medium. Exposure to high concentration of certain divalent cations, CaCl 2, makes a small fraction of cells permeable to foreign DNA. Each component cell incorporates a single plasmid DNA molecule, which carries an antibiotic-resistance gene. When the cells are treated wit antibiotics on plates, only a few of the transformed cells containing the antibiotics- resistance gene on the plasmid vector will survive.

Inserted Sequence Source of Nucleic acid to be cloned: -DNA directly from organism -DNA synthesized or amplified in vitro (cDNA or PCR reactions). -Previously cloned DNA. Generally a specific sequence. Quality of DNA can be crucial -Its purity, being free of contaminants -its size is crucial when cloning very large pieces

Two Important Enzymes Restriction Enzymes: cuts the DNA from any organism at specific sequences of a few nucleotides, generating a reproducible set of fragments. DNA Ligases: insert DNA restriction fragments into replicating DNA molecules producing recombinant DNA.

5` G A A T T C 3` Restriction Enzyme: EcoRI 3` C T T A A G 5` Cleavage 5` G A A T T C 3` 3` C T T A A G 5` Sticky ends DNA Ligases 3` T T A A P 5` OH + 3` T T A A P 5` OH 3` C G P 5` OH 3` T A C G P 5` OH A C B Complementary ends base-pair 5` A A T T 3` 3` T T A A 5` OH PP + Unpaired B and C 5` A A T T 3` 3` T T A A 5` DNA ligases Mechanism

Outline  What is cloning?  How to do cloning?  Validation  Application

Validation Because introducing DNA into an organism is usually not very efficient, we need to do validation. Selection- A technique that isolates only a particular type of cell or organism. Screen- A technique that allows identifying a particular type of cell or organism but does not isolate it from other types.

Selection EcoRI pBR322 Ampicillin Tet. R Amp. R Tet. R Amp. R Cell

Screen EcoRI Amp R. Tet. R pBR322 EcoRI Tet. R Tetracycline EcoRI Replica plating process Add Amp. The cells we want Cell

Other validation methods Inserted Gene EcoRI Promoter Ori. Multi. cloning site Ab. Resis. EcoRI About 100 bp About 500bp-5kb BamHI SalI PCR U.P. L.P. MarkerWith Prod.Without Prod. Restriction Enzyme MarkerWith Prod.Without Prod. +

Sequencing Dideoxy: (Sanger) Manual Primer extension reactions in four separate tubes. Using a dideoxy nucleotide as the chain terminator. Each tube contains different dideoxy nucleotide (ddATP, ddCTP, ddGTP, ddTTP). Radioactive dATP is also included in all the tubes so the DNA products will be radioactive. The results is a series of fragments of different lengths. Finally, autoradiography is performed to visualize the DNA fragments.

Dideoxy: (Sanger) Manual a) Primer extension reaction TACTATGCCAGA 20-base primer Replication with ddTTP TACTATGCCAGA 25-base primer ATGA T b) Product of the four reactions TACTATGCCAGA A Template: (21) (24)ATGA ATGATA(26) Product of ddA rxn TACTATGCCAGA ATG Template: (23) (28)ATGATACG ATGATACGG(29) Product of ddG rxn TACTATGCCAGA ATGATAC Template: (27) (31)ATGATACGGTC Product of ddC rxn TACTATGCCAGA ATAT Template: (22) (32) ATGAT ATGATACGGT(30) Product of ddA rxn (25) ATGATACGGTCT c) Electrophoresis of the Protein ddA ddC ddG ddT TCTGGCATAGTATCTGGCATAGTA

Sequencing Dideoxy: (Sanger) automated The “manual” sequencing technique is powerful but slow, thus Rapid automated sequencing methods are required. Still based on the procedure using dideoxy nucleotides, but tagged with a different fluorescent molecule, so the product from each tube will emit a different color fluorescence when excited by light After extension reaction and chain termination, all 4 solutions are mixed and electrophoresed together in the same lane on gel analyzed by laser beam The color of the fluorescent light emitted from each oligonucleotide is detected electronically

Outline  What is cloning?  How to do cloning?  Validation  Application

Application  Expression  Library

Expression Why? You want the cloned gene to make its product, normally a protein. Identifying gene from library requires expression. To overproduce the protein and purify it. For in vivo studies of the protein.

Expression Expression Vectors: Vectors that can yield the protein products of the cloned genes. Two elements that are required for active gene expression: a strong promoter and a ribosome binding site near an initiating ATG codon. The main function of an expression vector is to yield the product of a gene, therefore a strong promoter is necessary. The more mRNA is produced, the more protein product is made.

Inducible Expression Vectors Protein produced in a large quantity in bacteria can be toxic, so it is advantageous to keep a cloned gene repressed before expressing it. Solution: keep the cloned gene turned off by placing it downstream of an inducible promoter that can be turned off. IPTG strongly induce lac promoter

Expression Expression Vector that Produce Fusion Proteins Fusion proteins: Gene (or part of a gene) for one protein fused to part or all of a gene for a second protein. Major uses for generating fusion proteins: The ‘tag’ of the fusion protein can greatly aid biochemical purification. If the tag binds a particular substance, a column prepared containing that bound substance can be used to purify the tagged protein from virtually all other proteins. Oligohistidine regions like this have a high affinity for metals like nickel, so proteins that have such regions can be purified using nickel affinity chromatography ATG (His) 6 MCS

Fusion Protein The ‘tag’ can serve as a convenient way for identification of the tagged protein in cells or extracts. For example, a short peptides can be sufficient to use as a tag for antibody binding. In this way, a common antibody can be used, eliminating the need to develop a novel reagent specific to the protein of interest. The ‘tag’ can be used as a surrogate in the quantification of the tagged protein. Again, a routine assay of the activity of the tag can be used to monitor amounts of a protein of interest that may have no means of assay otherwise.

Library Construction A library is a collection of different cloned DNAs from a single source that are present in different copies of a particular cloning vector. Genomic library – for genome sequencing cDNA library – derived from mRNA of a particular tissue, for isolating specific genes

Library Construction The principle of library construction is basically quite simple. Cut a DNA vector at a unique restriction site and ligate into it the DNA that you want to make a library out of. If you want a library of human genomic DNA, you use fragmented human DNA. The ligation mix is not yet considered the library. The library comes after the generation of E. coli cells carrying the cloned DNA. To generate a library with a million clones for example, you need to recover a million independent colonies carrying plasmids or a million independent phage plaques. By pooling together all the independent clones you get the library.

Library Construction Though simple in principle, libraries are difficult to make well. Partly this is just a matter of scale. While in routine cloning, you generally just need to recover a single type of clone, a library has to generate very large numbers of independent DNA inserts. While used pretty frequently, libraries are seldom made. Few people have much experience. The best advice for making a library is to not do it unless you really have to. Get a library from someone else that has already made one. Some are commercially available.

Thanks Dr. Robert A. Scott All the members in the group Xiaoming Wang

Reference Manuscript of Course Genetics 8920 Molecular Biology Robert F. Weaver Molecular Cell Biology Lodish, Berk, Zipursky, Matsudaira, Baltimore, Darnell