Suppl. Figure 1 miR-107 levels NormalPituitary Tumors miR-103 levels miR-125b levels miR-141 levels miR-144 levels miR-164 levels miR-145 levels miR-143.

Slides:

Advertisements

Similar presentations

Supplementary Figure 1. Caspase 8 expression and activation and Fas expression in NSCLC and normal lung cell lines. A Western blot analysis of DR4 and.

Advertisements

1 Clustering analysis of tumor samples (IBC 20, nIBC 20) normals excluded sample type ER HER2 AB Figure. Results of hierarchical clustering analysis

Suppl. Figure 1 A B Suppl. Figure 1. Relative (A) miR-21 and (B) miR-224 expression levels in HCC tumors in different stages (I,II,III,IV) assessed by.

Supplementary table 1 miR-506 expression and clinocopathological factors FactorsTotal number miR-506 low expressionmiR-506 high expression P-value (n =

Mandal CC et al Supplementary Fig. S1. Increased expression of CSF-1 in human breast cancer cells. (A) The conditioned media from normal human breast epithelial.

-33 Red bar: tonsil tumour samples, n =14 x2 Green bar: tonsil normal samples, n = 9 x2 A B Supplementary Figure 1. A)Unsupervised HCL analysis was used.

Supplementary figure 5.

Volume 342, Issue 1, Pages (January 2014)

Inhibition of SOX17 by MicroRNA 141 and Methylation Activates the WNT Signaling Pathway in Esophageal Cancer Yan Jia, Yunsheng Yang, Qimin Zhan, Malcolm.

Figure 1. WA down-regulates H

Volume 141, Issue 5, Pages e1 (November 2011)

Bufalin Inhibits the Differentiation and Proliferation of Cancer Stem Cells Derived from Primary Osteosarcoma Cells through Mir-148a Cell Physiol Biochem.

Ke Xu, Ph.D. Putuo Hospital and Cancer Institute,

MicroRNA-101 Inhibits Growth, Proliferation and Migration and Induces Apoptosis of Breast Cancer Cells by Targeting Sex-Determining Region Y-Box 2 Cell.

Cell Physiol Biochem 2013;31: DOI: /

HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells Sugiko Watanabe, Yasuaki Ueda, Shin-ichi Akaboshi,

Effect of microRNA-135a on Cell Proliferation, Migration, Invasion, Apoptosis and Tumor Angiogenesis Through the IGF-1/PI3K/Akt Signaling Pathway in Non-Small.

The Long Non-Coding RNA XIST Interacted with MiR-124 to Modulate Bladder Cancer Growth, Invasion and Migration by Targeting Androgen Receptor (AR) Cell.

Volume 145, Issue 4, Pages e2 (October 2013)

Cell Physiol Biochem 2017;44:1867– DOI: /

Factor VII-Induced MicroRNA-135a Inhibits Autophagy and Is Associated with Poor Prognosis in Hepatocellular Carcinoma Kuang-Tzu Huang, I-Ying Kuo, Ming-Chao.

Cell Physiol Biochem 2015;36: DOI: /

Volume 144, Issue 3, Pages e4 (March 2013)

Volume 145, Issue 2, Pages (August 2013)

Circulating Exosomal miR-17-5p and miR-92a-3p Predict Pathologic Stage and Grade of Colorectal Cancer Fangfang Fu, Weiqin Jiang, Linfu Zhou, Zhi Chen

Volume 133, Issue 2, Pages (August 2007)

Andrea L Kasinski, Frank J Slack Molecular Therapy - Nucleic Acids

A Novel IMP1 Inhibitor, BTYNB, Targets c-Myc and Inhibits Melanoma and Ovarian Cancer Cell Proliferation Lily Mahapatra, Neal Andruska, Chengjian Mao,

Loss of SMARCA4 expression or activity derepresses miR-27a.

MicroRNA221-3p modulates Ets-1 expression in synovial fibroblasts from patients with osteoarthritis of temporomandibular joint J. Xu, Y. Liu, M. Deng,

Volume 137, Issue 2, Pages e2 (August 2009)

Volume 141, Issue 5, Pages e1 (November 2011)

Inhibition of SOX17 by MicroRNA 141 and Methylation Activates the WNT Signaling Pathway in Esophageal Cancer Yan Jia, Yunsheng Yang, Qimin Zhan, Malcolm.

MicroRNA-381 Represses ID1 and is Deregulated in Lung Adenocarcinoma

Volume 39, Issue 4, Pages (August 2010)

Volume 145, Issue 4, Pages e2 (October 2013)

Volume 17, Issue 4, Pages (April 2010)

Supplemental Figure S1. Expression of MYOCD, MYOCD ceRNA and miRNAs

MicroRNA Regulation of Stem Cell Fate

Volume 21, Issue 6, Pages (June 2013)

Volume 6, Issue 3, Pages (September 2004)

MicroRNAs and Parallel Stem Cell Lives

Uc.454 Inhibited Growth by Targeting Heat Shock Protein Family A Member 12B in Non- Small-Cell Lung Cancer Jun Zhou, Chenghai Wang, Weijuan Gong, Yandan.

Volume 17, Issue 4, Pages (April 2010)

Tyrosinase-Based Reporter Gene for Photoacoustic Imaging of MicroRNA-9 Regulated by DNA Methylation in Living Subjects Haifeng Zheng, Lin Zhou, Yaru.

Molecular Therapy - Nucleic Acids

Supplemental Figure S4. Expression changes of phased and non-phased siRNAs among the three tissues examined The expression changes of phased and non-phased.

Volume 145, Issue 2, Pages (August 2013)

Microarray analysis of phospho-Twist1–responsive genes.

miR-124 Inhibits Lung Tumorigenesis Induced by K-ras Mutation and NNK

Volume 147, Issue 6, Pages (December 2011)

Fold Change of hsa-miR-3687 (T/N)(log2)

Volume 19, Issue 8, Pages (August 2011)

Alterations in mRNA 3′ UTR Isoform Abundance Accompany Gene Expression Changes in Human Huntington’s Disease Brains Lindsay Romo, Ami Ashar-Patel, Edith.

Figure 7. Expression changes of phased and non-phased siRNAs among the three tissues examined The expression changes of phased and non-phased siRNAs between.

MicroRNA-381 Represses ID1 and is Deregulated in Lung Adenocarcinoma

Volume 19, Issue 6, Pages (June 2011)

An Epigenetic Switch Involving NF-κB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell Transformation Dimitrios Iliopoulos, Heather A. Hirsch,

Volume 25, Issue 5, Pages (May 2017)

Negative Regulation of Tumor Suppressor p53 by MicroRNA miR-504

The Expression of MicroRNA-598 Inhibits Ovarian Cancer Cell Proliferation and Metastasis by Targeting URI Feng Xing, Shuo Wang, Jianhong Zhou Molecular.

Volume 24, Issue 10, Pages (October 2016)

Figure 4. MicroRNA (miR)-195 and miR-497 directly targets CD274

Cytotoxic activity of HER2-lytic hybrid peptide.

PTENP1 expression is downregulated in ccRCC.

Correlation of miR-21 expression levels with DEGs in 28 bladder cancer cell lines. Correlation of miR-21 expression levels with DEGs in 28 bladder cancer.

Targeting DCLK1 by miRNA-137.

Volume 23, Issue 4, Pages (April 2015)

PARP1 suppresses the transcription of PD-L1 in cancer cells.

A B C Name Sequence TIMP3 promoter

Presentation transcript:

Suppl. Figure 1 miR-107 levels NormalPituitary Tumors miR-103 levels miR-125b levels miR-141 levels miR-144 levels miR-164 levels miR-145 levels miR-143 levels miR-15b levels miR-16 levels miR-186 levels let-7b levels Pituitary Tumors Normal Suppl. Figure 1. Evaluation of the expression levels of differentially expressed microRNAs between pituitary normal and cancer tissues. MicroRNA expression levels were assessed by real-time PCR analysis in 5 normal and 12 cancer pituitary tissues. The experiment has been performed in triplicate and data are shown as mean ± SD.

Suppl. Figure 2 UGUUAGGGAAUUUUACUUGAA UGGAUAGGACUUAAUGAACUU 8-mer 3UTR PTEN miR-26b PTEN UTR UGUGCAGCCACGUCACUGUGA UUUCUCUGGCCAAGUGACACU 8-mer 3UTR BMI1 miR-128 BMI UTR Suppl. Figure 2. Sequence complementarity between miR-26b and the 3UTR of PTEN gene and between miR-128 and the 3UTR of BMI1 gene.

Suppl. Figure 3 a as-miR NC # of colonies as-miR-26b siRNA NC siRNA-PTEN # of colonies as-miR NC as-miR siRNA NC siRNA-BMI1 b as-miR NC as-miR siRNA NC siRNA-BMI1 # of invading cells as-miR NC as-miR-26b siRNA NC siRNA-PTEN # of invading cells Suppl. Figure 3. MiR-26b and miR-128 control the tumorigenicity and invasiveness of AtT-20 pituitary tumors cell through regulation of PTEN and BMI1, respectively. (a) Number of colonies (mean ± SD) and (b) invading AtT-20 cells untreated or treated with 50nM antisense-microRNA negative control (as-miR-NC), antisense-microRNA-26b (as-miR-26b), antisense-microRNA-128 (as-miR-128), siRNA negative control (siRNA NC) and siRNA against PTEN (siRNA-PTEN).

# of colonies miR-NC as-miR-NC as-miR-26b miR-128 p< # of invading cells miR-NC as-miR-NC miR-128 p< as-miR-26b Suppl. Figure 4 a d PTEN mRNA levels miR-NC as-miR-NC as-miR miR-26b e bc miR-NC as-miR-NC as-miR miR-26b AKT phosph levels f # of colonies as-miR-26b miR-128 siRNA NC siRNA-PTEN # of invading cells as-miR-26b miR-128 siRNA NC siRNA-PTEN Suppl. Figure 4. MiR-26 and miR-128 regulate the PTEN-AKT pathway in AtT-20 pituitary cells. (a) Number of colonies and (b) invading AtT-20 cells, untreated or treated with 50nM miR-NC, as-miR-NC, as-miR-26b and miR-128. (c) Fold enrichment of BMI1 in the promoter area of PTEN in AtT-20 cells treated with 50NM as-miR-NC or as-miR-128, assessed by chromatin immunoprecipitation followed by real-time PCR analysis. (d) PTEN mRNA expression levels (mean ± SD) assessed by real-time PCR analysis and (e) AKT phosphorylation levels (S473) in AtT-20 cells treated for 48h with 50nM as-miR-NC, as-miR-128, miR- 26b and their combinations. (f) Number of colonies and invading AtT-20 cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD.

Suppl. Figure 5 GH3 MtT/S # of invading cells as-miR-26b miR-128 siRNA NC siRNA-PTEN Suppl. Figure 5. Number of invading GH3 and MtT/S cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD.