Lecture 11 Evolution and Development Animal development Phylogenetics: terms and analysis

Evolution: explanation for the diversity of life/form. Development: generation of form. Evo Devo is the synthesis of these.

General animal life cycle Soma Germ-line fertilization Somatic germ-line division

Animal development Sperm Egg Zygote Gametes Development

Origins of multicellularity Willmer Invertebrate relationships

Implicit phylogenys Primordial ooze worm rat chimp human Primordial ooze humanchimprat worm time

Metazoan origins Three techniques used A) examine living organisms B) examine the fossil record C) examine DNA sequence

Metazoan origins Considerations when looking at the living A Divergence vs convergence

Metazoan origins Considerations when looking at the living A Divergence vs convergence Human and Squid camera eyes

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny

Metazoan origins Polyphylogeny vs monophylogeny Polyphylogeny independent evolution of a characteristic Monophylogeny common ancestry

Evolution of a chitin exoskeleton Polyphylogeny Monophylogeny Proto-platyhelminthes No exoskeleton Insects Crustacea SpidersInsectsCrustaceaSpiders Common ancestor with an exoskeleton

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time blurs all origins

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time D data set in the present

First metazoans Willmer Invertebrate relationships

Pseudoceolomates Willmer Invertebrate relationships

Worms Willmer Invertebrate relationships

Mollusks Willmer Invertebrate relationships

Arthropods Willmer Invertebrate relationships

Deuterostomes Willmer Invertebrate relationships

Organization of the major animal groups Raff The shape of life

Organization of the major animal groups Raff The shape of life

Organization of the major animal groups Sponge Multicellular Multiple cell types No organized tissues Raff The shape of life

Organization of the major animal groups Diploblast Organized tissues Diploblastic ectoderm/endoderm Neuron-no CNS Sensory cells-no PNS Raff The shape of life

Organization of the major animal groups Acoelomate Triploblastic: ecto meso endoderms Single gut opening Bilaterally symmetric, A/P axis Organized CNS and PNS No body cavity Raff The shape of life

Organization of the major animal groups Pseudocoelomates One side of the body cavity lined with mesoderm Raff The shape of life

Organization of the major animal groups Eucoelomates Both sides of the body cavity lined with mesoderm Hydrostatic skeleton Circulatory system Raff The shape of life

Proposal for animal phylogeny Willmer Invertebrate relationships

Fossils When do we see the first fossil animals?

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found

Fossil sponges My old

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burrow trace fossils Surface trace fossils

Trace and body fossils Carroll et al., From DNA to diversity

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon

Lantian and Avalon Biota

Ediacarans: soft body preservation Raff The shape of life

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon Fossilized embryos Over 550 million years old

Doushantuo

Bacteria and not embryos?

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Burgess Chengjiang Doushantuo Lantian Avalon

Chengjiang

Burgess shales

Soft body preservation Regular preservation

Cambrian Ediacaran Cryogenian MarinoanSturtian 500Mya600Mya700Mya Porifera Snowball First fossils found Porifera Biomarker

Biomarkers

DNA sequence analysis Organism 1 ATGTCCGTGAGTCGTCGTAGCTGAT Organism 2 ATGTCCGTGAGTCGTCGTAGCTGAT Organism 3 ATGTCAGTGAGACGTCGTAGCTGAT Organism 4 ATGTCAGTGAGTCCTCATAGCTGAT Organism 5 AAGGCCGTGAGACCTCATAGCTGAT

rRNA 18S analysis Raff The shape of life

Choanoflagellates Cambell Biology

Choanoflagellates Cambell Biology GENOME SEQUENCE RECENTLY COMPLETED

Traditional phylogeny based on the coelum

Simple to complex

DNA analysis tells a different story

Pseudocoelomy is polyphylogenic Priapulids NematodesRotifers coelomates

H Philippe et al. Nature 470, (2011) doi: /nature09676 Animal phylogeny based on mitochondrial proteins reconstructed using the CAT+GTR+ Г model under a Bayesian analysis

DNA analysis tells a different story Complex to simple

Odontogriphus reburrus: early lophotrochozoan Morris and Caron Science 315, 1255

JN Liu et al. Nature 470, (2011) doi: /nature09704 Reconstruction of Diania cactiformis in dorsolateral view. Jointed armored velvet worm Transitional form. 520Mya

Base groups Complex to simple

Problem with sponges: complex to simple?

Protostome/ Deuterostome split Chordata Mullusca Cambrian Vendian Molecular clock analysis

ChordataMullusca Cambrian Vendian Molecular clock Biomarker analysis Protostome/ Deuterostome split

A complex organism existed at the protostome deuterostome split Carroll et al., From DNA to diversity

Is the study of living organisms the study of the radiation of Urbilateria? Carroll et al., From DNA to diversity