Tuning Tophat2 Belinda Giardine
Tophat2 Aligns reads from RNA to the genome Ribonucleic acid (RNA) is a ubiquitous family of large biological molecules that perform multiple vital roles in the coding, decoding, regulation, and expression of genes. Adds on dealing with gaps in the alignments by breaking the reads into small pieces ~20 bases and reassembling the reads after mapping. Though the new version is more parallel still slow (more than 4 days for recent runs) It uses Bowtie to do the actual mapping
RNA-seq image from wikipedia fastq file, a single 1:N:0:NAAGGC GAATGCCCCCGGCCGTCCCTCTTAATCATGGCCTCAGTTCCGAAAACCANCAAAATAGAACCGCGGTCCTA TTNN +
Tophat2 Pipeline written in C++ (34,351 lines of code in 63 files) Wrapper written in Python 3 of the programs use Boost pthreads long_spanning_reads.cpp segment_juncs.cpp tophat_reports.cpp Programs are compiled as one unit under autoconfig and automake, communication between programs with temporary files. Many prerequisites: zlib, Boost, samtools, Bowtie, this and the amount of file IO makes running on MIC only not feasible.
Data files Reads in fastq format, 20–200 million reads (2 x 20gb for my test) Reference sequence and indexes used for mapping 6gb for mouse Final output 14gb for my test
Work from last time Compiling start with gcc then icc then add –mmic (this failed in trying to get all the prerequisites) Test run on host, using Tophat’s log of run for time. Run on biostar(Xeon) using 8 threads took 26 hours Run on stampede (host) using 16 threads took 19 hours, 40 mins Run on stampede (host) using 32 threads took 24 hours
New work Python wrapper and long run times makes gprof and vtune difficult to profile code with. Going from my experience in Biostar, I am starting with segment_juncs executable. Keeping the temporary files that are used for passing data between programs, I ran just segment_juncs. Time for segment_junctions run alone: 8 threads 2 hours 13 minutes 16 threads 1 hour 15 minutes (2 ½ out of 19 ½ hours total) of this 76% is spent in the parallel section 32 threads 2 hours 12 minutes
Failed attempts Run vtune on segment_juncs times out of full data license errors Check loops in par_report that are assumed dependencies. lines of code indicated not loops or in loops? contradictory lines Offloading threaded section of code in segment_juncs.cpp. Will it actually improve speed or too much file IO? Lots of variables to copy File IO
Hardison Lab
vec_report3 segment_juncs.cpp(135): (col. 32) remark: loop was not vectorized: existence of vector dependence. segment_juncs.cpp(135): (col. 32) remark: vector dependence: assumed ANTI dependence between r line 135 and r line 135. segment_juncs.cpp(135): (col. 32) remark: vector dependence: assumed FLOW dependence between r line 135 and r line 135. Line 135: left_seg.left = max(0, T.right() - 2);
opt_report REMOVED VAR left_mismatches _V$78b REMOVED PACK left_mismatches REMOVED VAR right_mismatches _V$78d REMOVED PACK right_mismatches
gprof output for segment_juncs Each sample counts as 0.01 seconds. % cumulative self self total time seconds seconds calls Ts/call Ts/call name extend_from_seeds(std::vector >&, PackedSplice const&, std::vector >, std::allocator > > > const&, std::string const&, std::string const&, unsigned long, unsigned long, int) pack_splice(std::string const&, int, int, unsigned int) __do_global_dtors_aux pack_right_splice_half(std::string const&, unsigned int, unsigned int)
Parallel section of code: vector threads; for (int i = 0; i < num_threads; ++i) { SegmentSearchWorker worker; worker.rt = &rt; worker.reads_fname = left_reads_fname; worker.segmap_fnames = &left_segmap_fnames; worker.partner_reads_map_fname = right_reads_map_fname; worker.seg_partner_reads_map_fname = right_seg_fname_for_segment_search; worker.juncs = &vseg_juncs[i]; worker.deletions = &vdeletions[i]; worker.insertions = &vinsertions[i]; worker.fusions = &vfusions[i]; worker.read = READ_LEFT; worker.partner_hit_offset = 0; worker.seg_partner_hit_offset = 0; if (i == 0) { worker.begin_id = 0; worker.seg_offsets = vector (left_segmap_fnames.size(), 0); worker.read_offset = 0; } else { worker.begin_id = read_ids[i-1]; worker.seg_offsets.insert(worker.seg_offsets.end(), offsets[i-1].begin()+1, offsets[i-1].end()); worker.read_offset = offsets[i-1][0]; if (partner_offsets.size() > 0) worker.partner_hit_offset = partner_offsets[i-1]; if (seg_partner_offsets.size() > 0) worker.seg_partner_hit_offset = seg_partner_offsets[i-1]; } worker.end_id = (i+1 ::max(); //Geo debug: //fprintf(stderr, "Worker %d: begin_id=%lu, end_id=%lu\n", i, worker.begin_id, worker.end_id); if (num_threads > 1 && i + 1 < num_threads) threads.push_back(new boost::thread(worker)); else worker(); }