GENE TECHNOLOGY Chapter 8.

Slides:



Advertisements
Similar presentations
Chapter 20 DNA Technology & Genomics. Slide 2 of 14 Biotechnology Terms Biotechnology Process of manipulating organisms or their components to make useful.
Advertisements

Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. From Gene to Protein (an overview)
DNA Technology & Gene Mapping Biotechnology has led to many advances in science and medicine including the creation of DNA clones via recombinant clones,
Chapter 14: Genetic Engineering -Modification of the DNA of an organism to produce new genes with new characteristics.
Additional Powerful Molecular Techniques Synthesis of cDNA (complimentary DNA) Polymerase Chain Reaction (PCR) Microarray analysis Link to Gene Therapy.
Gene Cloning Techniques for gene cloning enable scientists to prepare multiple identical copies of gene-sized pieces of DNA. Most methods for cloning pieces.
Chapter 20: Biotechnology Ms. Whipple Brethren Christian High School.
Manipulating the Genome: DNA Cloning and Analysis 20.1 – 20.3 Lesson 4.8.
Bacteria Transformation
Concept 20.1: DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare well-defined segments.
Biotechnology Packet #26 Chapter #9. Introduction Since the 1970’s, humans have been attempted to manipulate and modify genes in a way that was somewhat.
Chapter 20 Biotechnology. Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Overview: The DNA Toolbox Sequencing of the.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Genetic Engineering Do you want a footer?.
Objective 2: TSWBAT describe the basic process of genetic engineering and the applications of it.
CHAPTER 20 BIOTECHNOLOGY: PART I. BIOTECHNOLOGY Biotechnology – the manipulation of organisms or their components to make useful products Biotechnology.
AP Biology: Chapter 14 DNA Technologies
Chapter 20 Notes: DNA Technology. Understanding & Manipulating Genomes 1995: sequencing of the first complete genome (bacteria) 2003: sequencing of the.
AP Biology Ch. 20 Biotechnology.
N Understanding and Manipulating Genomes n One of the greatest achievements of modern science –Has been the sequencing of the human genome, which was largely.
1 Genetics Faculty of Agriculture Instructor: Dr. Jihad Abdallah Topic 13:Recombinant DNA Technology.
What are the Techniques of Biotechnology ? Restriction Endonucleases: enzymes that cut DNA at specific codes (nucleotide sequences) –Can buy from suppliers:
Biotechnology Packet #12 Chapter #9. Introduction Since the 1970’s, humans have been attempted to manipulate and modify genes in a way that was somewhat.
AP Biology Biotechnology Part 3. Bacterial Cloning Process Bacterium Bacterial chromosome Plasmid Gene inserted into plasmid Cell containing gene of interest.
DNA Technology.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Ch. 20 Biotechnology. DNA cloning yields multiple copies of a gene or other DNA segment Gene cloning and other techniques, collectively termed DNA technology,
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert.
Items for tomorrow and beyond: 1) Study/read captions for all figures within Chapter 20 2) Read Section 20.5 (applications of biotechnology) on pp
DNA Technology. Overview DNA technology makes it possible to clone genes for basic research and commercial applications DNA technology is a powerful set.
Biotechnology.
Chapter 20: Biotechnology. Overview: The DNA Toolbox Sequencing of the human genome was completed by 2007 DNA sequencing has depended on advances in technology,
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings PowerPoint ® Lecture Presentations for Biology Eighth Edition Neil Campbell.
DNA TECHNOLOGY AND GENOMICS CHAPTER 20 P
Biotechnology What does it mean? Tools and Technologies Selected Applications Biotechnology 1: any method based on knowledge of biological processes that.
Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Overview: The DNA Toolbox In recombinant DNA, nucleotide sequences from.
GENETIC ENGINEERING CHAPTER 20
Concept 20.1: DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare well-defined segments.
Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.
Chapter 20: DNA Technology and Genomics - Lots of different techniques - Many used in combination with each other - Uses information from every chapter.
Biotechnology The manipulation of organisms or their genes for –Basic biological research –Medical diagnostics –Medical treatment (gene therapy) –Pharmaceutical.
Chapter 20: Part 1 DNA Cloning and Plasmids
This shortened week 2/17 Review Biotech ~Quiz tomorrow viruses and biotech Prokaryotes Friday and Monday.
CHAPTER 20 BIOTECHNOLOGY. Biotechnology – the manipulation of organisms or their components to make useful products Biotechnology is used in all facets.
Gene Cloning & Creating DNA Libraries. Клонирование генов Что означает термин «клонирование»? Как происходит клонирование генов? Чем это отличается от.
Introduction to Biotechnology Transformation and more!
DNA Technology and Genomics
Figure 20.0 DNA sequencers DNA Technology.
Fig Figure 20.1 How can this array of spots be used to compare normal and cancerous tissues?
DNA Technologies (Introduction)
Figure 20.2 Overview of gene cloning
DNA Technology Packet #27.
Chapter 20: DNA Technology and Genomics
DNA Tools & Biotechnology
Biotechnology: Part 1 DNA Cloning, Restriction Enzymes and Plasmids
Chapter 20 Biotechnology.
and PowerPoint “DNA Technology,” from
Chapter 20 – DNA Technology and Genomics
Chapter 20 Biotechnology.
Chapter 14 Bioinformatics—the study of a genome
Screening a Library for Clones Carrying a Gene of Interest
DNA Tools & Biotechnology
Biotechnology.
CHAPTER 20 DNA TECHNOLOGY.
DNA Technology Packet #50 Chapter #20.
Chapter 20 Biotechnology.
DNA Technology and Genomics
Chapter 20: DNA Technology and Genomics
GENE TECHNOLOGY Chapter 13.
Presentation transcript:

GENE TECHNOLOGY Chapter 8

Overview DNA Cloning Restriction Enzymes Gel Electrophoresis and Southern Blotting Gene Expression Detection Organismal Cloning Applications of Gene Technology Medical Environmental Agricultural Ethical Issues

Overview: The DNA Toolbox Sequencing of the human genome was completed by 2007 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the same DNA molecule

Methods for making recombinant DNA are central to genetic engineering, the direct manipulation of genes for practical purposes DNA technology has revolutionized biotechnology, the manipulation of organisms or their genetic components to make useful products An example of DNA technology is the microarray, a measurement of gene expression of thousands of different genes

Fig. 20-1 Figure 20.1 How can this array of spots be used to compare normal and cancerous tissues?

DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare gene-sized pieces of DNA in identical copies, a process called DNA cloning

DNA Cloning and Its Applications: A Preview Most methods for cloning pieces of DNA in the laboratory share general features, such as the use of bacteria and their plasmids Plasmids are small circular extra-chromosomal DNA molecules that replicate separately (autonomously) from the bacterial chromosome Cloned genes are useful for making copies of a particular gene and producing a protein product

Gene cloning involves using bacteria to make multiple copies of a gene Foreign DNA is inserted into a plasmid, and the recombinant plasmid is inserted into a bacterial cell Reproduction in the bacterial cell results in cloning of the plasmid including the foreign DNA This results in the production of multiple copies of a single gene

Cell containing gene of interest Bacterium Fig. 20-2a Cell containing gene of interest Bacterium 1 Gene inserted into plasmid Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome 2 2 Plasmid put into bacterial cell Figure 20.2 A preview of gene cloning and some uses of cloned genes Recombinant bacterium

Recombinant bacterium Fig. 20-2b Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested 4 Basic research and various applications Basic research on gene Basic research on protein Figure 20.2 A preview of gene cloning and some uses of cloned genes Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Figure 20.2 A preview of gene cloning and some uses of cloned genes Cell containing gene of interest Bacterium 1 Gene inserted into plasmid Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome 2 Plasmid put into bacterial cell Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested Figure 20.2 A preview of gene cloning and some uses of cloned genes 4 Basic research and various applications Basic research on gene Basic research on protein Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Using Restriction Enzymes to Make Recombinant DNA Bacterial restriction enzymes cut DNA molecules at specific DNA sequences called restriction sites A restriction enzyme usually makes many cuts, yielding restriction fragments The most useful restriction enzymes cut DNA in a staggered way, producing fragments with “sticky ends” that bond with complementary sticky ends of other fragments DNA ligase is an enzyme that seals the bonds between restriction fragments

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-1 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-2 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA One possible combination

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-3 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA One possible combination 3 DNA ligase seals strands. Recombinant DNA molecule

Fig. 20-UN5

Fig. 20-UN6

Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Cloning a Eukaryotic Gene in a Bacterial Plasmid In gene cloning, the original plasmid is called a cloning vector A cloning vector is a DNA molecule that can carry foreign DNA into a host cell and replicate there

Producing Clones of Cells Carrying Recombinant Plasmids Several steps are required to clone the hummingbird β-globin gene in a bacterial plasmid

Fig. 20-4-1 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-2 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-3 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carrying plasmids Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-4 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carrying plasmids Figure 20.4 Cloning genes in bacterial plasmids RESULTS Colony carrying non- recombinant plasmid with intact lacZ gene Colony carrying recombinant plasmid with disrupted lacZ gene One of many bacterial clones

TCCATGAATTCTAAAGCGCTTATGAATTCACGGC AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG Fig. 20-UN4 5 TCCATGAATTCTAAAGCGCTTATGAATTCACGGC 3 3 AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG 5 Aardvark DNA G A A T T C T T A C A G Plasmid

Fig. 20-UN7

The hummingbird genomic DNA and a bacterial plasmid are isolated Both are digested with the same restriction enzyme The fragments are mixed, and DNA ligase is added to bond the fragment sticky ends Some recombinant plasmids now contain hummingbird DNA The DNA mixture is added to bacteria that have been genetically engineered to accept it The bacteria are plated on a type of agar that selects for the bacteria with recombinant plasmids This results in the cloning of many hummingbird DNA fragments, including the β-globin gene

Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Storing Cloned Genes in DNA Libraries A genomic library that is made using bacteria is the collection of recombinant vector clones produced by cloning DNA fragments from an entire genome A genomic library that is made using bacteriophages is stored as a collection of phage clones

Foreign genome cut up with restriction enzyme Fig. 20-5a Foreign genome cut up with restriction enzyme or Recombinant phage DNA Bacterial clones Recombinant plasmids Phage clones Figure 20.5a, b Genomic libraries (a) Plasmid library (b) Phage library

A bacterial artificial chromosome (BAC) is a large plasmid that has been trimmed down and can carry a large DNA insert BACs are another type of vector used in DNA library construction

Large insert with many genes Large plasmid Fig. 20-5b Large insert with many genes Large plasmid BAC clone Figure 20.5c Genomic libraries (c) A library of bacterial artificial chromosome (BAC) clones

A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell A cDNA library represents only part of the genome—only the subset of genes transcribed into mRNA in the original cells

Fig. 20-5 Foreign genome cut up with restriction enzyme Large insert with many genes Large plasmid or BAC clone Recombinant phage DNA Bacterial clones Recombinant plasmids Phage clones Figure 20.5 Genomic libraries (a) Plasmid library (b) Phage library (c) A library of bacterial artificial chromosome (BAC) clones

DNA in nucleus mRNAs in cytoplasm Fig. 20-6-1 Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-2 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-3 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-4 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene DNA polymerase

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-5 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene DNA polymerase cDNA

Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.

Screening a Library for Clones Carrying a Gene of Interest A clone carrying the gene of interest can be identified with a nucleic acid probe having a sequence complementary to the gene This process is called nucleic acid hybridization

For example, if the desired gene is A probe can be synthesized that is complementary to the gene of interest For example, if the desired gene is – Then we would synthesize this probe (Why??) … … 5 G G C T A A C T T A G C 3 3 C C G A T T G A A T C G 5

The DNA probe can be used to screen a large number of clones simultaneously for the gene of interest Once identified, the clone carrying the gene of interest can be cultured

Radioactively labeled probe molecules Fig. 20-7 TECHNIQUE Radioactively labeled probe molecules Probe DNA Gene of interest Multiwell plates holding library clones Single-stranded DNA from cell Film • Figure 20.7 Detecting a specific DNA sequence by hybridizing with a nucleic acid probe Nylon membrane Nylon membrane Location of DNA with the complementary sequence

Expressing Cloned Eukaryotic Genes After a gene has been cloned, its protein product can be produced in larger amounts for research Cloned genes can be expressed as protein in either bacterial or eukaryotic cells

Bacterial Expression Systems Several technical difficulties hinder expression of cloned eukaryotic genes in bacterial host cells To overcome differences in promoters and other DNA control sequences, scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter

Eukaryotic Cloning and Expression Systems The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors helps avoid gene expression problems YACs behave normally in mitosis and can carry more DNA than a plasmid Eukaryotic hosts can provide the post-translational modifications that many proteins require

One method of introducing recombinant DNA into eukaryotic cells is electroporation, applying a brief electrical pulse to create temporary holes in plasma membranes Alternatively, scientists can inject DNA into cells using microscopically thin needles Once inside the cell, the DNA is incorporated into the cell’s DNA by natural genetic recombination

Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

TECHNIQUE 5 3 Target sequence Genomic DNA 3 5 Fig. 20-8a Figure 20.8 The polymerase chain reaction (PCR)

Cycle 1 yields 2 molecules Fig. 20-8b 1 Denaturation 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension Figure 20.8 The polymerase chain reaction (PCR) New nucleo- tides

Cycle 2 yields 4 molecules Fig. 20-8c Cycle 2 yields 4 molecules Figure 20.8 The polymerase chain reaction (PCR)

molecules; 2 molecules (in white boxes) match target sequence Fig. 20-8d Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Figure 20.8 The polymerase chain reaction (PCR)

molecules; 2 molecules (in white boxes) match target sequence Fig. 20-8 TECHNIQUE 5 3 Target sequence Genomic DNA 3 5 1 Denaturation 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleo- tides Figure 20.8 The polymerase chain reaction (PCR) Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence

Animation Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.