Chapter 13 - Molecular Methods Objectives Be able to describe what a gene probe is and what it can be used for. Understand the PCR reaction. Be able to describe the different types of PCR: normal, RT-PCR, ICC-PCR, multiplex PCR, seminested PCR, PCR fingerprinting, real-time PCR, in situ PCR. Be able to give an example of the use of each of these types of PCR. Understand the different types of PCR fingerprinting techniques including AP-PCR, REP-PCR, ERIC-PCR. Be able to give an example application of a PCR fingerprinting technique. Understand RFLP and its application to forensics. Be able to define cloning, cloning vector, and alpha-complementation. Understand the concept of metagenomic analysis Understand DGGE and TRFLP analysis and its use in community analysis. Be able to define what a reporter gene is and know the different types of reporter genes. Be able to give an example of how each of the different types reporter genes is used. Be able to define what a microarray is and to give an example of how a microarray could be used to monitor a microbial community.

Molecular techniques are based on the structure of DNA and RNA

CCTAAAGTGGCATTACCCTTGAGCTA Gene probes A gene probe is a short specific sequence of DNA that is used to query whether a sample contains “target” DNA, or DNA complementary to the gene probe. Gene probe (usually 100-500 bp in length) ACCGTAAT Single strand of DNA CCTAAAGTGGCATTACCCTTGAGCTA Target sequence The target sequence can be a universally conserved region such as the 16S-rDNA gene or it can be in a region that is conserved within a specific genus or species such as the nod genes for nitrogen fixation by Rhizobium or the rhl genes for rhamnolipid biosurfactant production by Pseudomonas aeruginosa.

PCR-Polymerase Chain Reaction In many cases there is not enough DNA in a sample for a gene probe to detect. Sample DNA can be amplified using PCR. Need: Target DNA Primers: 17 to 30bp, GC content >50% Primers can be for universal conserved sequences (16S rDNA, dehydrogenase genes) or genus-level conserved sequences (Nod, Rhl, LamB genes) dNTPs DNA polymerase (original was taq polymerase from Thermus aquaticus. Now there are several other DNA polymerases available)

PCR Round 1 target DNA Double-stranded DNA Denaturation 5' 3' Double-stranded DNA Denaturation 5' 3' Primer annealing 5' 3' 3' 5' Extension Extension 3' 5' repeat PCR cycles DNA polymerase always adds nucleotides to the 3’ end of the primer

3' 5' PCR Round 2 5' 3' After the second round of PCR, the number of long strands increases arithmetically and the number of short strands increases exponentially (the number of chromosomal strands is always the same). denaturation 3' 5' primer annealing 3' 5' Short strand extension Long strand Chromosomal strand

Temperature control in a PCR thermocycler 94 0C - denaturation 50 – 70 0C - primer annealing 72 0C - primer extension 94 0C - denaturation

[DNA] # PCR cycles After 25 cycles have 3.4 x 107 times more DNA plateau is reached after 25-30 cycles # PCR cycles

A PCR product should be confirmed in at least two ways initially. These can include: Correct product size. Sequence the product. Use a gene probe to confirm the product. Use seminested PCR (see later)

RT-PCR The enzyme reverse transcriptase is used to make a DNA copy (cDNA) of an RNA template from a virus or from mRNA. Normal PCR with two primers

Multiplex PCR Use of multiple sets of primers to detect more than one organism or to detect multiple genes in one organism. Remember, the PCR reaction is inherently biased depending on the G+C content of the target and primer DNA. So performing multiplex PCR can be tricky. or

Seminested PCR Three primers are required, the normal upstream and downstream primers as well as a third, internal primer. Two rounds of PCR are performed, a normal PCR with the upstream and downstream primer, and then a second round of PCR with the downstream and internal primer. A second smaller product is the result of the second round of PCR.

ICC-PCR Integrated cell culture PCR is used for virus detection. Cell culture takes 10 – 15 days. PCR alone detects both infectious and noninfectious particles. So use a combination of these techniques: grow the sample in cell culture 2 – 3 days, release virus from cells and perform PCR. This results in the detection of infectious virus in a shorter time with a 50% cost savings. It also allows use of dilute samples which reduces PCR inhibitory substances.

Labelling approaches Real-Time PCR CYBR green TAQ-man probes This technique allows quantitation of DNA and RNA. Reactions are characterized by the point in time during cycling when amplification of a PCR product is first detected rather than the amount of PCR product accumulated after a fixed number of cycles. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. TAQ-man probes In the simplest and most economical format, that reporter is the double-strand DNA-specific dye SYBR® Green (Molecular Probes). SYBR Green binds double-stranded DNA, and upon excitation emits light. Thus, as a PCR product accumulates, fluorescence increases. The advantages of SYBR Green are that it's inexpensive, easy to use, and sensitive. The disadvantage is that SYBR Green will bind to any double-stranded DNA in the reaction, including primer-dimers and other non-specific reaction products, which results in an overestimation of the target concentration. For single PCR product reactions with well designed primers, SYBR Green can work extremely well, with spurious non-specific background only showing up in very late cycles. TaqMan Probes are oligonucleotides that contain a fluorescent dye, typically on the 5' base, and a quenching dye, typically located on the 3' base. When irradiated, the excited fluorescent dye transfers energy to the nearby quenching dye molecule rather than fluorescing, resulting in a nonfluorescent substrate. TaqMan probes are designed to hybridize to an internal region of a PCR product. During PCR, when the polymerase replicates a template on which a TaqMan probe is bound, the 5' exonuclease activity of the polymerase cleaves the probe. This separates the fluorescent and quenching dyes and FRET no longer occurs. Fluorescence increases in each cycle, proportional to the rate of probe cleavage. FRET probes 15

PCR fingerprinting AP-PCR (arbitrarily primed PCR), 1 primer required, 10-20 bp, no sequence information required REP-PCR (repetitive extragenic palindromic sequences) 2 primers insert randomly into the REP sites ERIC-PCR (enterobacterial repetitive intergenic consensus sequences), 2 primers insert randomly into the ERIC sites, best for Gram Negative microbes All of these fingerprinting techniques tell one if two isolates are the same or different. They do not provide information about the identity or relatedness of the organisms

RFLP Fingerprinting Analysis RFLP = restriction fragment length polymorphism RFLP analysis involves cutting DNA into fragments using one or a set of restriction enzymes. For chromosomal DNA the RFLP fragments are separated by gel electrophoresis, transferred to a membrane, and probed with a gene probe. One advantage of this fingerprinting technique is that all bands are bright (from chromosomal DNA) because they are detected by a gene probe. AP-PCR, ERIC-PCR, and REP-PCR all have bands of variable brightness and also can have ghost bands. For PCR products a simple fragment pattern can be distinguised immediately on a gel. This is used to confirm the PCR product or to distinguish between different isolates based on restriction cutting of the 16S-rDNA sequence “ribotyping”. Also developed into a diversity measurement technique called “TRFLP”.

Recombinant DNA techniques Cloning – the process of introducing a foreign piece of DNA into a replication vector and multiplying the DNA. Recombinant DNA - foreign DNA inserted into a vector. These approaches are used to: Find new or closely related genes Insert genes into an organism, e.g., an overproducer Produce large amounts of a gene Cloning

Recombinant DNA

Selection of recombinants by alpha complementation

Metagenomics Genetic analysis of an entire microbial community. Metagenomics involves the cloning of large fragments of DNA extracted from the environment, allowing analysis of multiple genes encoded on a continuous piece of DNA as well as allowing screening of large environmental fragments for functional activities. Two main approaches: sequence analysis of all DNA present advantage: allows unparalleled access to the genetic information in a sample disadvantage: difficulty in organization and interpretation of the sequenced information obtained from complex communities directed sequencing for identity (16S rRNA gene or a functional gene) advantage: allows rapid access to specific identity or functional data from an environmental sample disadvantage: provides more limited information about the sample

DGGE Analysis DGGE – denaturing gradient gel electrophoresis DGGE is a way to separate multiple PCR products of the same size. These products can be generated by a 16S-rRNA PCR of community DNA. DGGE uses either a thermal or a chemical denaturing gradient to separate bands on the basis of their G+C content. Once the bands are separated they can be sequenced to allow identification. The banding patterns themselves can be used to evaluate whether changes in the population are taking place. Note of caution: PCR is inherently biased, some primers work better with some target sequences than others and primers will preferentially amplify targets that are present in high concentration. So scientists still don’t know how accurately this type of analysis depicts the population actually present.

TRFLP Analysis TRFLP = (terminal restriction fragment length polymorphism analysis) A way to separate multiple PCR products of the same size. These products can be generated by a 16S-rRNA PCR of community DNA The PCR is performed as usual with two primers, but one is fluorescently labeled The PCR products are then cut up using a restriction enzyme The fluorescently labeled PCR pieces are detected TRFLP steps: 1. Extract community DNA 2. Perform 16S rRNA PCR using fluorescently-labeled primer 3. Choose a restriction enzyme for TRFLP that will give the greatest diversity in restriction product size Colored bars represent different sequences. Red spirals indicate fluorescent label. Colored circles, squares, and rectangles indicate different restriction enzyme sites and their location in each sequence. The above graphic shows the fragments in order on each sequence. The numbers in graphic below indicate the relative abundance of each sequence, and the fragments have been re-ordered according to size. The fragment analysis peaks would look something like the graph on the right.. 

Gel electrophoresis analysis Automated DNA analyzer

Some approaches for analysis of the various bacterial communities present in environmental samples Culture and identify via 16S-rRNA PCR and sequencing Extract DNA, subject to 16S-rRNA PCR, clone, then sequence “clone libraries” 3. Extract DNA, subject to metagenomic analysis 4. Extract DNA, subject to 16S-rRNA PCR, then DGGE analysis 5. Extract DNA, subject to 16S-rRNA PCR, then TRFLP analysis Discuss the advantages and disadvantages of each of these approaches

Reporter genes Reporter genes are genetic markers that are inserted into the organism of interest to allow easy detection of the organism or its activity. Examples of reporter genes: lux genes (luminescence), gfp genes (green fluorescent protein), beta-galactosidase gene (produces blue color). insert reporter gene

Microarrays Constructed using probes for a known nucleic acid sequence or for a series of targets, a nucleic acid sequence whose abundance is being detected. GeneChip microarrays consist of small DNA fragments (referred to also as probes), chemically synthesized at specific locations on a coated quartz surface. By extracting, amplifying, and labeling nucleic acids from experimental samples, and then hybridizing those prepared samples to the array, the amount of label can be monitored at each feature, enabling either the precise identification of hundreds of thousands of target sequence (DNA Analysis) or the simultaneous relative quantitation of the tens of thousands of different RNA transcripts, representing gene activity (Expression Analysis). The intensity and color of each spot provide information on the specific gene from the tested sample.

Affymetrix gene arrays for specific organisms: Arabidopsis Genome Arrays B. subtilis Genome Array (Antisense) Barley Genome Array C. elegans Genome Array Canine Genome Array Drosophila Genome Arrays E. coli Genome Arrays Human Genome Arrays Mouse Genome Arrays P. aeruginosa Genome Array Plasmodium/Anopheles Genome Array (malaria) Rat Genome Arrays S. aureus Genome Array Soybean Genome Array Vitis vinifera (Grape) Array Xenopus laevis Genome Array Yeast Genome Arrays Zebrafish Genome Array

Microarray technology is developing fast beyond pure culture: In 2005, arrays are containing > 250,000 probes. In 2006, arrays are containings > 500,000 probes. Microarray analysis is developing the next generation of chips to examine “who” is in environmental samples and “what” they do: Phylochip is a microarray with DNA signatures for 9000 known species in the phyla of Bacteria and Archaea to examine “who” is there. Geochip is a microarray with DNA signatures for various functional genes to examine “what” functions are present