RNA folding, anti-HIV aptamer design, and human telomerase RNA activity Shi-Jie Chen Department of Physics & Astronomy Department of Biochemistry University of Missouri-Columbia

RNA (ribonucleic acid) Primary Structure P O c P O c c 7 torsional angles per nt to specify the 3D structure of an RNA

Base pairing and stacking U

2D (contact map) and 3D structures Theimer and Feigon et al, Mol. Cell., 17, , 2005 Human telomerase RNA

Telomerase controls the elongation of telomere When the telomere become critically short, the cell is unable to replicate. Thus, telomerase is important in cell division and normal development.

Secondary structure of human telomerase RNA (hTR) Chen, Blasco & Greider, Cell, 100, 503 (2000)

Need an entropy theory. Conf entropy is intrinsically a 3D problem. Vfold model S-J Chen “RNA Folding: Conformational Statistics, Folding Kinetics, and Ion Electrostatics” Annual Review of Biophysics 2008

RNA conformations described by torsions of the virtual bonds W. Olson & Flory 1972 S Cao & S-J Chen 2008 C O N1 (primidine: U, C) N9 (purine: A, G) C4 C5 O5 P

Backbone virtual bond torsions are rotameric (t, g-) (t, t)(g-, t) (t, t) (g +,t) C3’-endo C2’-endo Wadley and Pyle et al. JMB, 2007 P C4 P N1/9 diamond lattice θ η C4 P P

RNA conformational ensemble  Random walk of the virtual bonds in diamond lattice

The Vfold model – a general tool

The model requires no any fitting parameters. The computations are from first principles. Actual loop is quite rigid, how to account for this effect in the loop conformational enumeration in the Vfold model?

: The free energy of the coaxial stacking between two stems (S 1 and S 2 ) Sequence  structure Vfold model gives better predictions than Pknots, which ignores the contribution of loop entropy. Cao & Chen, Nucleic Acids Res, 2006

Pseudoknot motifs (a) H-type pseudoknot (b) H-type pseudoknot with structured loops (c) Secondary structure + pseudoknot (d) Several H-type pseudoknots TYMVTMV BWYV SARS

2D structure prediction SE=SP=1 for perfect accuracy nt, 22 sequences Ren, J., Rastegari, B., Condon, A., Hoos, H.H. (2005) RNA. Cao & Chen (2009) RNA

Free energy landscape Shi-Jie Chen. Annual Review of Biophysics 2008

RNA folding energy landscape is bumpy Sashital, Cornilescu & Butcher. NSMB 2004; Madhani & Guthrie. Cell 1992 Cao & Chen. JMB 2005

Secondary structure of human telomerase RNA (hTR)

Loop-stem (helix) tertiary interactions

: The free energy of the coaxial stacking between two stems (S 1 and S 2 ) Loop-helix interactions are functionally important in RNA pseudoknot  human disease Theimer and Feigon et al, Mol. Cell., 17, , 2005

Loop-stem base triple interaction 9

Predicting loop-stem base triple interactions Protonated C.(C-G) and C.(G-C): (-14 kcal/mol, -38 cal/mol.K) unprotonated: (-7 kcal/mol, -19 cal/mol.K) (1)Vfold  chain entropy +

Disruption of the loop-stem base triple The Vfold model gives good predictions on structures and folding stabilities

Nucleotide sequence  2D structure, stability, free energy landscape

RMSD = 2.2 A Multiscale all-atom tertiary structure prediction Sugarcane Yellow Leaf Virus (ScYLV)

Secondary structure can be slave to tertiary contacts. Correct structure Inhibition of the tertiary contact  structural switch loop-helix contacts Wrong structure

Anti-HIV RNA aptamer design Aptamers that bind reverse transcriptase (RT) inhibit its activity in enzymatic assays and block viral replication whe expressed in cells. Many RNA aptamers to RT form pseudoknots Donald Burke

AGA ACUGAA UUCCG U AGGGC UGACUU A A U Jaeger, Restle, Steitz (1998) EMBO J

AGA ACUGAA UUCCG U AGGGC UGACUU A A U Jaeger, Restle, Steitz (1998) EMBO J

Anti-HIV aptamer design Can computational approach guide an experimental search for new aptamers? and can experimentation guide refinement of computational theory?

80.63 GCCACACUCCACUCUCGACCGUUUCUUGGGUUCUUCGGGAAAAAAAGCAACCUACUAUUG ACUAUCGACGAAGAUCUGUU 134gauucggaugcuccgguagcucaaccug 3’ The location of a fluorescently labeled primer on a denaturing gel Physics theory guides drug design loop-helix contacts ?

80.63 GCCACACUCCACUCUCGACCGUUUCUUGGGUUCUUCGGGAAAAAAAGCAACCUACUAUUG ACUAUCGACGAAGAUCUGUU 134gauucggaugcuccgguagcucaaccug 3’ The location of a fluorescently labeled primer on a denaturing gel Physics theory guides drug design full length D. Burke

Pseudoknot folding kinetics and human Telomerase RNA activity

Telomerase controls the elongation of telomere When the telomeres become critically short, the cell is unable to replicate. Thus, telomerase is important in cell division and normal development.

Secondary structure of human telomerase RNA (hTR) Chen, Blasco & Greider, Cell, 100, 503 (2000)

Conformational switch and hTR function pseudoknot hairpin 179 Comolli et al Theimer et al. 2003

Conformational switch and hTR function 179 Chen & Greider 2005 ( 179AG/110CU mutation to destabilize the hairpin) AG UC X pseudoknot hairpin X

Rate model

Reduced conformational ensemble 40 nt: 10 confs Cao & Chen, Biophys J Native-like & misfolded

Theory-experiment agreement PK5 Wyatt, Puglisi, and Tinoco 1990 Cao & Chen 2005 JMB

hTR: hairpin as a kinetic intermediate Hairpin  pseudoknot switch exists The function may be kinetically controlled. The mutation expt alone cannot negate the role of conf switch. Cao & Chen 2005 JMB

We proposed two structures that are correlated to the telomerase activity: A long-lived transient hairpin intermediate & the native pseudoknot. Mutants such as 107AG and ∆U177 which forbid the formation of the native pseudoknot or hairpin intermediate result in the loss of telomerase activity.

Acknowledgment Song Cao Gengsheng Chen Liang Liu Zoia Kopeikin (MU) Zhijie Tan (Wuhan U) Wenbing Zhang (Wuhan U) Donald Burke (U Missouri) Juli Feigon (UCLA) David Giedroc (Indiania U) Samuel Butcher (U Wisconssin) NSF MCB , NSF MCB NIH R01 GM Ion electrostatics Folding kinetics Tertiary structural folding