Kuhlmann et al. Suppl. Figure 1. Kuhlmann et al. Suppl. Figure 2 SRA-domainSET-domain Gabi-Kat_516A07 SALK_079574 At2g33290 SUVH2 SRA-domainSET-domain.

Slides:

Advertisements

Similar presentations

Kuhlmann et al. Suppl. Figure 4 A bisulfite sequencing CG CHG CHH Δ open: unmethylated filled: methylated.

Advertisements

Jungwirth et al. Suppl. Fig. 1 A B. Jungwirth et al. Suppl. Fig. 2 HCT-116  -actin Bim EL Bak Bax - + KP46 A A C KP46 (µM) hours.

Suppl Figure S1. mMDH genes in At and t-DNA mutant characterization. A) MDHs in Arabidopsis B) T-DNA insertions available At1g53240 mMDH1 At3g15020 mMDH2.

Perpendicular and Parallel Lines Name: _________________________________ Directions: Read each question below. Circle the best answer. 1. Which figure.

P449. p450 Figure 15-1 p451 Figure 15-2 p453 Figure 15-2a p453.

P247. Figure 9-1 p248 Figure 9-2 p251 p251 Figure 9-3 p253.

Temporary Internal Distraction as an Aid to Correction of Severe Scoliosis by Jacob M. Buchowski, David L. Skaggs, and Paul D. Sponseller JBJS Essent Surg.

Chapter 6: Concurrent and Parallel Forces (Ewen et al. 2005) Objectives: Define torque. Define torque. Solve rotational problems using the formal definition.

Topics in Bioengineering Maura. Fun Links and Inspiration

Teo et al. Figure S1a lox66 cre SacI-cre-F PCR, SacI/EcoRI cleavage and ligation to SpeI-lox66-SacI adapter T4 DNA ligase-mediated ligation cre EcoRI-cre-R.

a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c

Figure 3 from Interannual variability of nitrogen oxides emissions from boreal fires in Siberia and Alaska during 1996–2011 as observed from space (Image.

The History of ARM and Microcontrollers Chapter 1

Copyright © 2017 American Academy of Pediatrics.

Supplementary Figure 1 Shiota et al.

Copyright © 2015 by the American Osteopathic Association.

حول مفهوم الذبح الحلال في الإسلام؟

Checklist for Site Reconnaissance (Sabatini et al_2002)

Figure 3 Life expectancy at birth in all countries included

10X dilution x ~10nM full – length competitor

The RNA components of eukaryotic RNase P and RNase MRP have multiple common structural features including the P3 domain. The RNA components of eukaryotic.

Figures & Tables from the textbook.

Is NF-κB2/p100 a direct activator of programmed cell death?

Volume 100, Issue 1, Pages (January 2000)

Kelly Howell, Oliver Hobert Neuron

פחת ורווח הון סוגיות מיוחדות תהילה ששון עו"ד (רו"ח) ספטמבר 2015

Objective 1A f(x) = 2x + 3 What is the Range of the function

Figure 3 The cell cycle and the role of CDK4/6 inhibition

Figure 1 Percentages of patients with first seizure experiencing a recurrent seizure over time This graph is based on a fixed-effect pooled percentage.

Volume 2, Issue 6, Pages (November 2009)

Alexander Stein, Reinhard Jahn Neuron

Figure 3 Societal costs for the care of patients with chronic kidney disease in the UK Figure 3 | Societal costs for the care of patients with chronic.

Figure 1 CAR-T-cell design

Kan et al. Suppl. Fig. S1 A B Yellowstone Lake Inflated Plain Otter

Finding the Missing Code of RNA Recognition by PUF Proteins

Short-Bowel Syndrome Clinical Gastroenterology and Hepatology

Structure Prediction: How good are we?

Structural Surprises from the Flaviviruses and Alphaviruses

Figure 3 Challenges for big data applications in cardiovascular care

Piecewise Graphs Lesson 7.4 Page 100.

Sequencing at 10,000x using Illumina paired reads

Nat. Rev. Endocrinol. doi: /nrendo

Lutz et al, Neuropsychopharmacology

Eukaryotic Transcription Activation: Right on Target

Laasch, O. & Conaway, R. (2016). Responsible Business: The Textbook for Management Learning, Competence and Innovation. Sheffield: Greenleaf Publishing.

Figure 6 The neurogenic components of angina

Nat. Rev. Nephrol. doi: /nrneph

Learning Target: I can determine if a relation is a function.

Relations, Domain and Range

Supplementary Figure 2 Shiota et al.

A connectionist model in action

Roth et al, Supplementary Figure 1

Figure S4 control-siRNA Day 0 fes A-siRNA Day 3 fer 1-siRNA

Kidney Disease Among African Americans: A Population Perspective

Figure Overview.

Catherine M. Pound et al. Hospital Pediatrics 2017;7:

Customizing SysML for Specific Domains

Figure 7-1: Non-Pipelined Instruction Execution vs. 2-stage Pipeline

UK paediatric cardiac surgery mortality rate by year for all cases and total number of procedures performed between 2000 and 2009/2010. UK paediatric cardiac.

In the Literature: Cognitive Impairment in Hemodialysis Patients

NOAH: pCR Results Patients (%) P=0.002 P=0.003 P=0.29 P=0.43 With T

Figure 6 Multiple target epitopes exist in the N-terminal domains of Caspr2 (A) Multidomain deletion constructs of Caspr2 were generated to determine which.

A B D C E F Supplementary Figure S4. Epping et al. IP: flag input IgG

Asimakopoulou et al., Suppl. Figure 7

Mean number of problems across the PPE-15 domains for each month of the program (pooled data across all 15 PPE-15 domains). Mean number of problems across.

Presentation transcript:

Kuhlmann et al. Suppl. Figure 1

Kuhlmann et al. Suppl. Figure 2 SRA-domainSET-domain Gabi-Kat_516A07 SALK_ At2g33290 SUVH2 SRA-domainSET-domain At4g13460 SUVH9 SALK_ SALK_ LB-p1::SUL1-p35S> RB RB <p35S-SUL1::P1-LB Gabi-Kat_516A07 TGAACGGCAA 1937bp1946bp CTGCAACTAG pAC161

Kuhlmann et al. Suppl. Figure 3 SUVH2 / PFK rel. RNA SUVH9 / PFK rel. RNA ACT2 / PFK rel. RNA wt suvh2 suvh9 suvh2 suvh9 A B C D E

Kuhlmann et al. Suppl. Figure 5 % methylation Wt Pro35S-mycSUVH2 leaves leaves A % methylation Wt Wt Pro35S-mycSUVH2 leaves seedlings leaves B total C CG CHG CHH

Kuhlmann et al. Suppl. Figure 6 24mer - wt suvh2 suvh9 wt suvh2 suvh9 AtSN1 (A) tRNA EtBr

Kuhlmann et al. Suppl. Figure 7 A B C D total CCGCHGCHH

PCR SUVH2 PCR SUVH9 PCR PFK PCR ACT2 Kuhlmann et al. Suppl. Figure 8

Suppl. Table: Sequences of used primes Primers used for genotyping: suvh2: SUVH2-gaby-F: ATATGCAGGTGTAGTTGTCACGAG SUVH2-gaby-R: ATGGCGAGCTTGCCGTTCACTTC T-DNA-insertion pAC161: pAC161 5´-out: ATATTGACCATCATACTCATTGC pAC161-F (NOS): GATGTCCGCAGCGTTATTATAAAATG PAC161-R (NOS): CGCATAATCTCAGACCAATCTGA suvh9: SUVH9-SALK-F: ATGGGTTCTTCTCACATTCCTCTTG SUVH9-SALK-R: CAGTGATCCTCACTAGCTCCGACG T-DNA-insertion pROK2: pROK2 3´-out: GAAATATTTGCTAGCTGATAGTG pROK2-F (pNOS): GAGCGGAGAATTAAGGGAG pROK2-R (pNOS): GAGAACCTGCGTGCAATC Primers used for qPCR: At4g04040 (Phospfofructokinase, Kapoor et al., 2005): F (B8F): gccacgaaaaccaaacagac R (B8R): ccggaatttcgatcaatcct At3g18780 (Actin-2 An et al., 1996): F: tgagagattcagatgcccagaa R: ttgattccagcagcttccat At2g33290 (SUVH2): F: atatgcaggtgtagttgtcacgag R: atggcgagcttgccgttcacttc At4g13460 (SUVH9): F: atgggttcttctcacattcctctt R: cagtgatcctcactagctccgacg AtSN1-A (AtSN1- Fragment A): F (F4) aaaataagtggtggttgtacaagc R (ATS15): accaacgtgctgttggcccagtggtaaatc AtSN1-B (AtSN1- Fragment B): F (A205): tgagagatttaccactgggccaaca R (A206): tgaggagctcaacacataaatggcaata AtSN1-C (AtSN1- Fragment C): F (A207): cctttccaagacaccatctcaacaac R (A208): tcctcaacaaaaataattccgaacgac Primers used for converted target regions: AtSN1 (chromosome III, nucleotides 15,805,617–15,805,773) : AtSN1-bi-F: caatatacratccaaaaaacarttattaaaataatatcttaa (JP 1821, Johnson et al., 2008) AtSN1-bi-R: gttgtataagtttagttttaattttayggatyagtattaattt (JP 1822, Johnson et al., 2008) AtCopia4: AtCopia4-bi-F: ggttgtytgtgttttttatggttyagattttata (JP 3100, Johnson et al., 2008) AtCopia4-bi-R: ataactraaccacarattcaracccattttcattt (JP 3101, Johnson et al., 2008) Primers used for quantitative amplification of genomic regions after ChIP: At4g04040 (Phospfofructokinase, beta-subunit, Mathieu et al., 2003): F: gccacgaaaaccaaacagac R: ccggaatttcgatcaatcct At3g18780 (Actin-2 An et al., 1996): F: tgagagattcagatgcccagaa R: ttgattccagcagcttccat Ta3-LTR (Johnson et al., 2002): F (JP1617): tagggttcttagttgatcttgtattgagctc R (JP1618): tttgctctcaaactctcaattgaagttt AtSN1-A (AtSN1- Fragment A, Herr et al., 2005): F (F4) aaaataagtggtggttgtacaagc R (ATS15): accaacgtgctgttggcccagtggtaaatc AtSN1-B (AtSN1- Fragment B): F (A205): tgagagatttaccactgggccaaca R (A206): tgaggagctcaacacataaatggcaata AtSN1-C (AtSN1- Fragment C): F (A207): cctttccaagacaccatctcaacaac R (A208): tcctcaacaaaaataattccgaacgac Kuhlmann et al. Suppl. Table