Cancer Care Engineering: Studies on Oxidative Damage and SNPs Lisa M. Kamendulis, PhD James E. Klaunig, PhD Indiana University 1

Question: Is oxidative stress status altered in individuals with polyps or colorectal cancer? Approach Whole blood collected and processed from 235 individuals for: – Comet Analysis (Direct and Oxidative DNA damage) – Total Antioxidant Capacity (TEAC) – Focused SNP analysis Samples: – 104 controls – 92 polyps – 27 colon cancer 11 with 1 follow-up; 4 with 2 follow-up – 12 rectal cancer 3 with 1 follow-up; 2 with 2 follow-up – SNPs evaluated only on samples from the initial visit What Modulates Oxidative Stress? Dietary and lifestyle influences high fat diet, alcohol, smoking, etc.  increased levels Antioxidants  decreased levels Inflammation Sources: Mitochondria Endothelial Cells Immune Cells (including microglia) Peroxisomes Metabolism (P450) (Xenobiotics) Antioxidants GSH, Vitamin E, VitC, SOD, Catalase, etc Pro-oxidants H 2 O 2, O 2 -, HO, 1 O 2 2

Comet data (235 samples analyzed): Total Antioxidant Capacity (TEAC) Data (235 samples analyzed): Question: Is oxidative stress status altered in individuals with polyps or colorectal cancer? 3

Question: Do differences exist in SNPs for oxidative stress and damage, and selective genes associated with colorectal cancer? Oxidative Stress – Catalase – SOD2 – NOS3 – GSTP – GSTM1 DNA Damage/Repair – APEX1 – XRCC – OGG1 – TP53 Inflammation – IL-6 – IL-8 – PTGS2 (COX2) Vitamin D Status – VDR – CASR – CYP24A1 Metabolism – CYP1A2 – CYP3A4 SNPs evaluated (129 samples analyzed) 4

5 APEX1 (I64V) CASR (A986S) Catalase (-262 C/T) CYP1A2 (5') CYP24A1 (intron) GSTM1 (N173K) GSTP1 (I105V) IL6 (5') IIIVVVAAASSS -- NNNKKK IIIVVV -- AAAGGG GTTTCCCTTTCCCTTTAAAGGGCCCGGG --AAAGGGCCCGGG Control (57) Polyp (52) Colon Ca (15) Rectal Ca (5) IL8 (5') NOS3 (E298D) OGG1 (S326C) PTGS2 PTGS2 (Ex ) SOD (A16V) TP53 (P72R) VDR (intron) XRCC (Q399R) -- EEEDDDSSSCCC -- VVVAAA RRRPPP -- RRRQQQ AAATTTGGGTTTCCCGGGCCCTTTAAAGGGAAAGGG CCCGGGCCCTTTCCCTTT Control (57) Polyp (52) Colon Ca (15) Rectal Ca (5) Question: Do differences exist in SNPs for oxidative stress and damage, and selective genes associated with colorectal cancer?

GSTM1 null shown to be protective, % null population decreases in colorectal cancer Polymorphism in promoter region of COX2 reported to change transcriptional activity. Not previously reported in colon cancer I64V amino acid change, function unknown. No differences observed in this population. 6

Next Steps Complete sample and data analysis – 3 additional samples collected – SNPs completed on all 235 samples Data Analysis/Evaluation – SNP tools – Correlation analysis with other endpoints 7