1 CA García Sepúlveda MD PhD Protein Localization, Translocation & Trafficking Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad.

Slides:



Advertisements
Similar presentations
Targeting of Proteins to the Organelles
Advertisements

Lesson 3: Translation.
Membranes of the Eukaryotic Cell Biology. Definition of a cell:  basic structural and functional unit of life  the smallest units that display the characteristics.
1 CA García Sepúlveda MD PhD Tema 12 Localización y translocación proteica Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad Autónoma.
Intracellular Compartments and Protein Sorting Haixu Tang School of Informatics.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Cell organelles in terms of structure and function.
Cell and Molecular Biology Behrouz Mahmoudi Cell Organelles-1 1.
Intracellular Compartments and Protein Sorting
Chapter 26 Protein Sorting. Chapter Objectives Understand the pathways of cotranslational processing of proteins – ER, Golgi, Plasma membrane, Lysosomes.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
1.Set up 110 µl mix for each primer/DNA combo on ice! µl 100x F primer (1 pMol/µl = 1µM final []) µl 100x R primer 3.11 µl 10x PCR buffer
Post-Translational Events I Translocation of Newly Synthesized Proteins into Membranous Organelles.
2 Protein Targeting pathways Protein synthesis always begins on free ribosomes In cytoplasm 1) Post -translational: proteins of plastids, mitochondria,
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Cell Structure and Function Chapter 3 Basic Characteristics of Cells Smallest living subdivision of the human body Diverse in structure and function.
Cell Structure and Function
PROTEIN TRAFFICKING AND LOCALIZATION PROTEINS SYNTHESIZED IN CYTOPLASM, BUT BECOME LOCALIZED IN CYTOPLASM CYTOPLASMIC MEMBRANE PERIPLASM OUTER MEMBRANE.
Translation Translation is the process of building a protein from the mRNA transcript. The protein is built as transfer RNA (tRNA) bring amino acids (AA),
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Cell Organelles and Features. Plasma/Cell Membrane Found in both prokaryotes and eukaryotes Structure: Composed of: phospholipids, cholesterol, and proteins.
Chapter 1 What is a Cell? By Benjamin Lewin. 1.1 Introduction Cells arise only from preexisting cells. Every cell has genetic information whose expression.
Major Constituents of Cell
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Lecture 6 Intracellular Compartments and Protein Sorting.
Step 2 of Protein Synthesis
Protein synthesis decodes the information in messenger RNA
ROUGH ENDOPLASMIC RETICULUM
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Section 1 Cellular Structure and Function Cell Discovery and Theory
CHAPTER 6 SYSTEMS BIOLOGY OF CELL ORGANIZATION
The Endoplasmic Reticulum (ER) Jill, Edward, and Nicole.
How do proteins fold? Folding in a test-tube The structure of proteins is determined by the amino acid sequence; many proteins in solution can be unfolded.
Chapter 3 Membrane targeting of proteins By D. Thomas Rutkowski & Vishwanath R. Lingappa.
Protein targeting to organelles 1.From the birth place to the destination— general principles 1)The problem: One place to make protein but many destinations—how.
Cellular compartmentalization Pages Q1 Name at least two of the three protein complexes involved in the electron transport chain?
© 2003 By Default!Slide 1 Protein Sorting, Transport and modification part1 M. Saifur Rohman, MD, PhD, FIHA.
Molecular Cell Biology
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 13 Moving Proteins into Membranes.
Introduction to Cell Structure and Function 08/2007 Lecture By Dr. Dirk M. Lang Dept. of Human Biology Faculty of Health Sciences University of Cape Town.
Fates of Proteins in Cells See also pages in Goodman.
Functions of the Nucleus 1. Role in cell division. 2. Influences cytoplasmic events. 3. Contains codes for protein synthesis.
Chapte r 8 Protein localization. 8.1 Introduction 8.2 Chaperones may be required for protein folding 8.3 Post-translational membrane insertion depends.
Cell Structure.
Endomembrane System Yasir Waheed NUST Center of Virology & Immunolgy National University of Sciences &Technology.
LECT 20: PROTEIN SYNTHESIS AND TRANSLATIONAL CONTROL High fidelity of protein synthesis from mRNA is essential. Mechanisms controling translation accuracy.
com/watch?v=Pfu1D E9PK2w CELL MEMBRANE.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
1 CA García Sepúlveda MD PhD Chaperones. Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad Autónoma de San Luis Potosí.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Chapter 12 Intracellular Compartments and Protein Sorting.
Cell Theory -The cell is the structural and functional unit of life Human adults are made up of an estimated 100,000,000,000,000 cells Organismal activity.
 The endoplasmic reticulum (ER) in the cells of eukaryotic organisms is an interconnected network of flattened, membrane-enclosed sacs or tubes known.
Cell Biology & Biochemistry Series : Set 4 Version: 1.0.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Protein targeting or Protein sorting Refer Page 1068 to 1074 Principles of Biochemistry by Lehninger & Page 663 Baltimore Mol Cell Biology.
4.4 Eukaryotic cells are partitioned into functional compartments  Membranes within a eukaryotic cell partition the cell into compartments, areas where.
Cell Structures and Their Functions. Cell Structure Highly Organized Highly Organized. Specialized structures called organelles in a jelly like substance.
Protein degradation rate varies 100x
Post-Translational Events I Protein Trafficking
Protein Localization Chapter Introduction Figure 10.1.
Protein Synthesis and Sorting: A Molecular View
Protein Sorting & Transport
Organelles And Their Functions
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
Intracellular Compartments and Transport
Presentation transcript:

1 CA García Sepúlveda MD PhD Protein Localization, Translocation & Trafficking Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad Autónoma de San Luis Potosí

2 Introduction Proteins can be classified into two general classes with regard to localization: those that are not associated with membranes; and those not-associated with membranes. Each class can be subdivided further, depending on whether the protein associates with a particular structure in the cytosol or type of membrane. Proteins can be localized co-translationally or post-translationally. Protein fate

3 Post-translational localization Proteins that are localized post-translationally are released into the cytosol after synthesis on free ribosomes. Protein fate

4 Post-translational localization Proteins that are localized post-translationally are released into the cytosol after synthesis on free ribosomes. Some have signals for targeting to organelles such as the nucleus or mitochondria. Protein fate

5 Co-translational localization Proteins localized co-translationally associate with the ER membrane during synthesis, ribosomes are "membrane-bound". Protein fate

6 Co-translational localization Proteins localized co-translationally associate with the ER membrane during synthesis, ribosomes are "membrane-bound". The proteins pass into the ER along the Golgi and then through the plasma membrane, unless they have signals that cause retention at one of the steps on the pathway. Protein fate

7 Co-translational localization Proteins localized co-translationally associate with the ER membrane during synthesis, ribosomes are "membrane-bound". The proteins pass into the ER along the Golgi and then through the plasma membrane, unless they have signals that cause retention at one of the steps on the pathway. They may also be directed to other organelles, such as endosomes or lysosomes. Protein fate

8 Cytosolic proteins Cytosolic (or "soluble") proteins carry out functions in the cytosol. The ribosomes on which these proteins are synthesized are sometimes called "free ribosomes". The "default" for a protein released from "free" ribosomes is to remain in the cytosol. To be targeted to a specific location requires an appropriate signal, typically a sequence motif that causes it to be assembled into a macromolecular structure or recognized by a transport system.

9 Cytosolic proteins Some proteins remain free in the cytosol in quasi-soluble form; others associate with macromolecular cytosolic structures (filaments, microtubules, centrioles, etc). This class also includes nuclear proteins (which pass into the nucleus through large aqueous pores).

10 Reticuloendothelial system aka: Endomembrane System Series of membranous bodies, including ER, Golgi apparatus, endosomes and lysosomes. Proteins of this system are inserted into the ER and then directed to their particular locations by the vessicle transport system. –Proteins that are secreted from the cell are transported to and through the plasma membrane to the exterior.

11 Reticuloendothelial system There are three major subdivisions of the endomembrane system – the secretory pathway –the lysosomal pathway and –the endocytotic pathway

12 Reticuloendothelial system There are three major subdivisions of the endomembrane system – the secretory pathway –the lysosomal pathway and –the endocytotic pathway

13 Reticuloendothelial system There are three major subdivisions of the endomembrane system – the secretory pathway –the lysosomal pathway and –the endocytotic pathway

14 Reticuloendothelial system Once proteins enter the endoplasmic reticulum they never return to the cytosol compartment. They are carried by vesicle transport to the other compartments of the system. This flow of vesicles is highly regulated.

15 Reticuloendothelial system Consists of compartments: –Endoplasmic Reticulum –Golgi apparatus –Lysosomes –Endosomes and –Secretory Vesicles.

16 Reticuloendothelial system Compartments involved in the processing of proteins for: –export from the cell –for lysosomes (destruction) –for proteins entering the cell from the cell surface.

17 Reticuloendothelial system Compartments involved in the processing of proteins for: –export from the cell –for lysosomes (destruction) –for proteins entering the cell from the cell surface.

18 Reticuloendothelial system Compartments involved in the processing of proteins for: –export from the cell –for lysosomes (destruction) –for proteins entering the cell from the cell surface.

19 Protein Translocation The process of inserting into or passing through a membrane is called protein translocation. Protein translocation is driven by signals intrinsic to the proteins themselves.

20 Translocation Signals Nuclear localization signals (short sequences within proteins) enable the proteins to pass through nuclear pores. One type of signal that determines transport to the peroxisome is a very short C- terminal sequence. –Insulin signal peptide →

21 ER Targeting Synthesis of all proteins begins in the cytosol compartment. For proteins entering the secretory or lysosomal pathways, the first step is targeting to the ER.

22 ER Targeting This targeting relies on a signal encoded in the N terminal portion of the protein.

23 ER Targeting The signal is recognized by a Signal Recognition Particle (SRP).

24 ER Targeting The SRP enables the ribosome to dock to the corresponding translocator protein (translocon).

25 ER Targeting The SRP enables the ribosome to dock to the corresponding translocator protein (translocon).

26 ER Targeting Signal sequence provides the same traffikcing pattern for completely distinct proteins...

27 ER Targeting Nascent polypeptide is inyected into ER and the signal sequence is cleaved by a Signal Peptidase.

28 ER Targeting Protein synthesis continues to completion until the ribosome is undocked & dissociated.

29 ER Targeting This is a prime example of a co-translationally localized protein...now on to explore post-translational localization...

30 ER Targeting What about proteins synthesized in the cytosol that are incorporated to the ER ?

31 ER Targeting What about proteins synthesized in the cytosol that are incorporated to the ER ? The peptide moves through the translocon into the lumen of the ER. The signal peptide remains attached to the membrane. Signal peptide is cleaved off by a signal peptidase. Leaving the protein free in the lumen of the ER.

32 ER Targeting And what about proteins that become an INTEGRAL PART OF THE ER MEMBRANE ?

33 ER Targeting As membrane proteins are being translated, they are translocated into the ER until a hydrophobic domain is encountered. Alpha helices serve as a 'stop transfer' signal and leaves the protein inserted in the ER membrane.

34 ER Targeting The orientation of a protein in the membrane is established when it is first inserted into the membrane. This orientation persists all of the way to its final destination. That is, the cytosolic side of membrane remains on the cytosolic side throughout all processes.

35 ER Targeting Classification based on the way the integral proteins are inserted into the membrane and on the times they pass through it.

36 ER Targeting Type I : Single pass, N-terminus in extracellular or luminal space. Leader sequence in N-terminus Leader sequence is cleaved inside the ER lumen.

37 ER Targeting Type II : Single pass, C-terminus in extracellular or luminal space. Leader sequence absent but protein introduced C-terminus first.

38 ER Targeting Type III : Polypeptide crosses the lipid bilayer multiple times (α-helix rich) Even (2,4,6) number of hydrophobic domains N- and C- on same side Odd (1,3,5) number of hydrophobic domains N- and C- on different sides

39 ER Targeting Lipid chain-anchored membrane proteins and GPI-anchored membrane proteins : Associated with the bilayer only by means of one or more covalently attached fatty acid chains. The latter is bound to the membrane by a glycosylphosphatidylinositol (GPI) anchor.

40 ER Targeting Luminal side becomes extracellular side for some proteins.

41 Endosymbiont Targeting Mitochondrial and chloroplast proteins are synthesized on "free" ribosomes. They associate with the organelle membranes by means of N-terminal sequences of ~25 amino acids that are recognized by receptors on the organelle envelope. –Because this process takes place after synthesis of the protein has been completed, it is called post-translational translocation.

42 Endosymbiont Targeting Same as for ER. Requires specific translocons and SRP. As endosymbionts have two membranes, two different types of translocons are needed –TOM –TIM –Incorporated proteins can be integrated into membranes as happens for ER proteins.

43 Protein Trafficking The "default pathway" takes a protein through the ER, into the Golgi, and on to the plasma membrane.

44 Protein Trafficking A polarized thyroid epithelial cell synthesizing soluble proteins: Polypeptides generated by RER membrane-bound polysomes, enter the lumen of RER. Proteins undergo core glycosylation and by interacting with chaperones acquire their conformation. –Proteins are then transported to the Golgi apparatus, where terminal glycosylation and other post-translational reactions take place.

45 Protein Trafficking In the Trans-Golgi network (TGN), mature proteins undergo sorting processes and are packed into transport vesicles. The vesicles carry soluble proteins (inside the vesicle) and membrane proteins (as integral vesicle membrane protein).

46 Protein Trafficking Proteins that reside in the ER possess a C-terminal tetrapeptide KDEL (Lys- Asp-Glu-Leu) which signals their return to the ER from the Golgi. COPI is a protein that coats vesicles that transports proteins from the cis end of the Golgi complex to the RER. This type of transport is termed retrograde transport.

47 Leader Sequence Hierarchies –Mitochondria synthesize only ~10 organelle proteins; chloroplasts ~50. –The majority of organelle proteins are synthesized in the cytosol by free ribosomes. They must then be imported into the organelle. –Post-translational membrane insertion depends on LEADER SEQUENCES. –Leaders for mitochondria/chloroplasts are usually hydrophilic, consisting of uncharged amino acids interrupted by basic amino acids, and lacking acidic amino acids.

48 Leader Sequence Hierarchies –The leader sequence contains all the information needed to localize a protein. –The leader sequence and the transported protein represent domains that fold independently to be recognized by receptors on the organelle envelope. –The attached polypeptide sequence plays no part in recognition of the envelope. –Complexity of endosymbiont proteins = outer membrane the intermembrane space the inner membrane the matrix.

49 Leader Sequence Hierarchies –A hierarchy of leader signals tells each protein where to localize. –The default endosymbiont pathway for protein localization takes a protein completely into the matrix. –This requires two signals (in the leader): Organelle recognition & outer membrane passage (first part of the leader sequence). Inner Membrane recognition & passage (second part). –Proteins that need to be held in intermembrane space or as integral inner membrane proteins require even more signals.

50 Leader Sequence Hierarchies –This requires two signals (in the leader): Organelle recognition & outer membrane passage (first part of the leader sequence). Inner Membrane recognition & passage (second part). Many uncharged amino acids Basic amino acids

51 Translocons (Translocation Channels) –There is a basic problem in passing a (largely) hydrophilic protein through a hydrophobic membrane. –The energetics of the interaction are highly unfavorable. –Translocating proteins move through an aqueous channel (translocon), interacting with the resident (integral) proteins rather than with the lipid bilayer.

52 Translocons (Translocation Channels) –When the signal sequence enters the translocon, the ribosome attaches, forming a seal so that the pore is not exposed to the cytosol. –Ribosome is bound by the interaction of the Signal Recognition Particle (SRP) and the SRP-receptor.

53 Translocons (Translocation Channels) –Sec61 Complex is the major component of the translocon: Sec61α Sec61β Sec61γ – Forms cylindrical oligomers (each of 3 to 4 heterotrimers) with a diameter of ~8.5nm and a central pore of ~2 nm.

54 Translocons (Translocation Channels) –A more complex translocon is required when a protein is inserted into a membrane post- translationally. Sec61 complex Four other Sec proteins Chaperone BiP (a member of the Hsp70 class) Supply of ATP –BiP prevents protein backslash due to Brownian Motion.

55 Nuclear Pore Complex (NPC) –The nucleus is segregated from the cytoplasm by an envelope consisting of two membranes. –The outer membrane is continuous with the ER in the cytosol. –The two membranes come into contact at openings called nuclear pore complexes (~3000 per cell). Pore provides a water-soluble channel between nucleus and cytoplasm. Nucleus and cytosol have the same ionic milieu !

56 Nuclear Pore Complex (NPC) –Nuclear pores are used for both import and export of material. –Proteins are synthesized in the cytosol so any protein required in the nucleus must be transported there. –Since all RNA is synthesized in the nucleus, the entire cytoplasmic complement of RNA (mRNA, rRNA, tRNA, and other small RNAs) must be exported from the nucleus.

57 Nuclear Pore Complex (NPC) –The entire pore complex has a diameter of about 120 nm. –Pore diameter is 50 nm wide and its "depth" is about 200 nm. –Mammalian is 120 MDalton and contains approximately 30 different protein components.

58 Nuclear Pore Complex (NPC) –Molecules of <5 kD that are injected into the cytoplasm appear virtually instantaneously in the nucleus. Freely permeable to ions, nucleotides and other small molecules. –Proteins between 5-50 kD diffuse at a rate that is inversely related to their size. Presumably determined by random contacts with the pore. It takes a few hours for the levels of an injected protein to equilibrate between cytoplasm and nucleus. Small proteins can enter the nucleus by passive diffusion (but they may also be actively transported). –Proteins >50 kD in size do not enter the nucleus by passive diffusion. Active transport required for their passage

59 Nuclear Pore Complex (NPC) –For a protein to pass through a NPC it must have a special signal sequence. –The most common motif responsible for import into the nucleus is the Nuclear Localization Signal (NLS). –Its presence is necessary and sufficient to sponsor import into the nucleus. –Mutation of the signal can prevent the protein from entering the nucleus –There is no apparent conservation of sequence of NLS signals short, rather basic stretch of amino acids. Proline residue usually breaks α-helix upstream of basic residues. Hydrophobic residues are rare.

60 Nuclear Pore Complex (NPC)