PERL Variables and data structures Andrew Emerson, High Performance Systems, CINECA

The “Hello World” program Consider the following: # # Hello World # $message=“Ciao, Mondo”; print “$message \n”; exit; # # Hello World # $message=“Ciao, Mondo”; print “$message \n”; exit;

Perl Variables $message is called a variable, something with a name used to hold one or more pieces of information. All computer languages have the ability to create variables to store and manipulate data. Perl differs from other languages because you do not specify the “type” (i.e. integer, real, character, etc.) only the “complexity” of the data.

Perl Variables Perl has 3 ways of storing data: 1.Scalar  For single data items, like numbers or strings. 2.Arrays  For ordered lists of scalars. Scalars indexed by numbers. 3.Associative arrays or “hashes”  Like arrays, but uses “keys” to identify the scalars.

Scalar Variables Examples # $no_of_chrs=24; # integer $per_cent_identity=0; # also integer $per_cent_identity=99.50; # redefined as real $pi = ; # floating point (real) $e_value=1e-40; # using scientific notation $dna=“GCCTACCGTTCCACCAAAAAAAA”; # string -double quotes $dna=‘GCCTACCGTTCCACCAAAAAAAA’; # string -single quotes # $no_of_chrs=24; # integer $per_cent_identity=0; # also integer $per_cent_identity=99.50; # redefined as real $pi = ; # floating point (real) $e_value=1e-40; # using scientific notation $dna=“GCCTACCGTTCCACCAAAAAAAA”; # string -double quotes $dna=‘GCCTACCGTTCCACCAAAAAAAA’; # string -single quotes

Scalar Variables CASE is important, $DNA ≠ $dna ; (true for all variables) Scalars must be prefixed with a $ whenever they are used (is there a $ ? Yes → it is a scalar). The next character should be a letter and not a number (true for all variables). Scalars can be happily redefined at any time (e.g. integer → real → string): # unlikely example $dna = 0; # integer $dna = “GGCCTCGAACGTCCAGAAA”; # now it’s a # string # unlikely example $dna = 0; # integer $dna = “GGCCTCGAACGTCCAGAAA”; # now it’s a # string

Doing things with scalars.. # $a =1.5; $b =2.0; $c=3; $sum = $a+$b*$c; # multiply by $b by $c, add to $a # while ($j<100) { $j++; # means $j=$j+1, i.e. add 1 to j print “$j\n”; } # $dna1=“GCCTAAACGTC”; $polyA=“AAAAAAAAAAAAAAAA”; $dna1.= $polyA; # add one string to another # (equiv. $dna1 = $dna1.$polyA) $no_of_bases = length($dna2); # length of a scalar # $a =1.5; $b =2.0; $c=3; $sum = $a+$b*$c; # multiply by $b by $c, add to $a # while ($j<100) { $j++; # means $j=$j+1, i.e. add 1 to j print “$j\n”; } # $dna1=“GCCTAAACGTC”; $polyA=“AAAAAAAAAAAAAAAA”; $dna1.= $polyA; # add one string to another # (equiv. $dna1 = $dna1.$polyA) $no_of_bases = length($dna2); # length of a scalar

More about strings.. There is a difference between strings with ‘ and “ # $nchr = 24; $message=“chromosones in human cell =$nchr”; print $message; $message = ‘chromosones in human cell =$nchr’; print $message; exit; # $nchr = 24; $message=“chromosones in human cell =$nchr”; print $message; $message = ‘chromosones in human cell =$nchr’; print $message; exit; single quotes double quotes OUTPUT chromosones in human cell =24 chromosones in human cell =$nchr OUTPUT chromosones in human cell =24 chromosones in human cell =$nchr

More about strings Double quotes “ interpret variables, single quotes ‘ do not: $dna=‘GTTTCGGA’; print “sequence=$dna”; print ‘sequence=$dna’; $dna=‘GTTTCGGA’; print “sequence=$dna”; print ‘sequence=$dna’; OUTPUT sequence=GTTTCGGA sequence=$dna OUTPUT sequence=GTTTCGGA sequence=$dna Normally you would want double quotes when using print.

‘tue’, = (‘adenine’, ‘guanine’, ‘thymine’, ‘cytosine’, ‘DEFINITION’, ‘tue’, = (‘adenine’, ‘guanine’, ‘thymine’, ‘cytosine’, ‘DEFINITION’, ‘ACCESSION’,... ); Arrays Collections of numbers, strings etc can be stored in arrays. In Perl arrays are defined as ordered lists of scalars and are represented with character. Initializing arrays with lists

Arrays - elements To access the individual array elements you use [ and ] o’,’lys’,’ser’,’phe’); # now mutate the peptide $poly_peptide[0]=‘val’; $i=0; # print out what we have while ($i<8) { print “$poly_peptide[$i] “; $i++; o’,’lys’,’ser’,’phe’); # now mutate the peptide $poly_peptide[0]=‘val’; $i=0; # print out what we have while ($i<8) { print “$poly_peptide[$i] “; $i++; } Look array index The numbers used to identify the elements are called indices.

Arrays - elements When accessing array elements you use $ - why ? Because array elements are scalar and scalars must have $poly_peptide[0] = $poly_peptide[0] = ‘val’; This means that you can have a separate variable called $poly_peptide because $poly_peptide[0] is part NOT $poly_peptide. This may seem a bit weird, but that's okay, because it is weird. Unix Perl Manual

Array indices start from 0 not 1 ; Array elements $poly_peptide[0]=‘var’; $poly_peptide[1]=‘ser’; $poly_peptide[7]=‘phe’; $poly_peptide[0]=‘var’; $poly_peptide[1]=‘ser’; $poly_peptide[7]=‘phe’; The last index of the array can be found from $#name_of_array, e.g. $#poly_peptide. You can also use negative indices: it means you count back from the end of the array. Therefore $poly_peptide[-1]= $poly_peptide[$#poly_peptide] = $poly_peptide[7]

Array properties Length of an array: $len = $#poly_peptide+1; The size of the array does not need to be defined – it can grow dynamically: # begin program $i=0; while ($i<100) { $polyA[$i]=‘A’; $i++; } # begin program $i=0; while ($i<100) { $polyA[$i]=‘A’; $i++; }

Useful Array functions PUSH and POP Functions commonly used for manipulating a stack: PUSH POP F.I.L.O = First In Last Out Very common in computer programs

Array functions – PUSH and POP # part of a program that reads a database into an array # open database etc # while ($line= ) { # push $line onto array }... while { $record = # pop line off and use it.... do something } # part of a program that reads a database into an array # open database etc # while ($line= ) { # push $line onto array }... while { $record = # pop line off and use it.... do something }

Scalar Contexts If you provide an expression (e.g. an array) when Perl expects a scalar, Perl attempts to evaluate the expression in a scalar context. For an array this is the length of an array: ; $length=$#poly_peptide+1; This is equivalent to Hence: while {.. while {.. array in scalar context = length of array

Special variables $_ Set in many situations such as reading from a file or in a foreach loop. $0 Name of the file currently being executed. $] Version of Perl being Contains the parameters passed to a Contains the command line arguments passed to the program. Perl defines some variables for special purposes, including: Some are read-only and cannot be changed: see man perlvar for more details.

Associative Arrays (Hashes) Similar to normal arrays but the elements are identified by keys and not indices. The keys can be more complicated, such as strings of characters. Hashes are indicated by % and can be initialized with lists like arrays: %hash = (key1,val1,key2,val2,key3,val3..);

Associative Arrays (Hashes) Examples %months=(‘jan’,31,’feb’,28,’mar’,31,’apr’,30); Alternatively, %months=(‘jan’=> 31, ’feb’=> 28, ’mar’=> 31, ’apr’=> 30); %months=(‘jan’=> 31, ’feb’=> 28, ’mar’=> 31, ’apr’=> 30); => is a synonym for, key value

Associative Arrays (Hashes) Further examples # %classification = (‘dog’ => ‘mammal’, ‘robin’ => ‘bird’, ‘snake’ => ‘reptile’); %genetic_code = ( ‘TCA’ => ‘ser’, ‘TTC’ => ‘phe’, ‘TTA’ => ‘leu’, ‘TTA’ => ‘STOP’ ‘CCC’ => ‘pro’,... ); # %classification = (‘dog’ => ‘mammal’, ‘robin’ => ‘bird’, ‘snake’ => ‘reptile’); %genetic_code = ( ‘TCA’ => ‘ser’, ‘TTC’ => ‘phe’, ‘TTA’ => ‘leu’, ‘TTA’ => ‘STOP’ ‘CCC’ => ‘pro’,... );

The elements of a hash are accessed using curly brackets, { and } : Associative Arrays (Hashes) - elements $genetic_code{TCA} = ‘ser’; $genetic_code{CCC} = ‘pro’; $genetic_code{TGA} = ‘STOP’; $genetic_code{TCA} = ‘ser’; $genetic_code{CCC} = ‘pro’; $genetic_code{TGA} = ‘STOP’; Note the $ sign: the elements are scalars and so must be preceded by $, even though they belong to a % (just as for arrays).

Associative Arrays (Hashes) – useful functions exists indicates whether a key exists in the hash if (exists $genetic_code{$codon}) {... }else { print “Bad codon $codon\n”; exit; } if (exists $genetic_code{$codon}) {... }else { print “Bad codon $codon\n”; exit; }

Associative Arrays (Hashes) – useful functions keys and values makes arrays from the keys and values of a = keys = values = keys = values %genetic_code; Often you will see code like the following: foreach $codon (keys %genetic_code) { if ($genetic_code{$codon} eq ‘STOP’) { last; # i.e. stop translating } else { $protein.= $genetic_code{$codon}; } foreach $codon (keys %genetic_code) { if ($genetic_code{$codon} eq ‘STOP’) { last; # i.e. stop translating } else { $protein.= $genetic_code{$codon}; }