DNA analysis Molecular genetic testing for cystic fibrosis Carolyn Tysoe Principal Clinical Scientist Royal Devon & Exeter NHS Foundation Trust

Outline DNA basics – structure, function, types of mutation Mutation detection Introduction to cystic fibrosis and CFTR gene CFTR mutations Testing strategy Case study

A C A TT G G AA GGTCTCGGG 5’3’ DNA nucleus mRNA GAG Glu GAG TGC Cys TGC TTC Phe AAG Lys DNA transcription and translation cytosol 3’5’ CUCGUUCACGAAGACCUC AAA GluLysCysPheCysGlu

Effects of single base substitutions Wild type GluLysCysPheCys Met LysCysPheCys Glu ATGATGAAGTGCTGCTTCTGCTGCGAGGAG Missense GluLysPheCys Met LysPheCys Glu ATGATGAAGCGCCGCTTCTGCTGCGAGGAG Arg Pathogenic? GluLysCysPhe Met LysCysPhe ATGATGAAGTGCTGCTTCTGATGA Nonsense Premature protein termination Stop

Splice site mutations DNA GT AG DNA Normal spliced mRNA DNA Exon skipping Intron inclusion DNA Use of a cryptic splice site

Deletions and insertions Wild type GluLysCysPheCys Met LysCysPheCys Glu ATGATGAAGTGCTGCTTCTGCTGCGAGGAG Frameshift GluLysCysPheCys Met LysCys ATGATGAAGTGTTGTTCTTCTGCGGCGAGG Ser Ala Arg of one or a few base pairs… Single exon deletion Normal …to one or a few exons

Mutation detection methods Look for known mutations eg OLA Search for unknown mutations eg sequencing Look for single or multi-exon deletions eg MLPA

Polymerase Chain Reaction (PCR) Primers can be fluorescently labelled – fragments separated by size and colour PCR primers have a common tail – use one primer to sequence all fragments Designed to work under the same conditions using MegaMix (mostly!) PCR setup on 96-well plate by Biomek robot Reagent lots recorded using 2D-barcoded tubes

Method depends on mutation spectrum of gene CFTR gene and cystic fibrosis

Cystic fibrosis What is the mode of inheritance? What is the incidence and carrier frequency? Who does it affect? What is the disorder characterised by?

Cystic Fibrosis Autosomal recessive Incidence 1: 2500 Affects children and young adults Carrier frequency 1: 25 Production of viscous mucus  obstructs ducts and glands  affects many organs  multisystem disease

Cystic Fibrosis What are the major clinical features? Any additional features?

Major Clinical features Lungs: Obstructive pulmonary disease Bacterial infection (Pseudomonas) Pancreas: Impaired exocrine pancreatic function  Insufficient secretion of lipolytic and proteolytic enzymes  Malabsorption, steatorrhoea, failure to thrive

Other clinical features Meconium ileus Rectal prolapse Obstructive jaudice Nasal polyps Sinusitis Clubbing of fingers Congenital bilateral absence of Vas Deferens (CBAVD) in males Reduced fertility in females

The CFTR gene Identified in 1989 Long arm chromosome 7 (7q31.2) 230kb of DNA 27 exons 6.1kb mRNA 1480 amino acids Name: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)

CFTR gene to protein mRNA

CFTR mutations What is the mutation spectrum? What is the most common mutation?

CFTR mutations 1546 mutations listed on mutation database

CFTR mutation spectrum Mutation typeFrequency of mutation type (%) Missense42 Frameshift16 Splicing13 Nonsense10 In Frame ins/del2 Large ins/del3 Promoter0.5 Polymorphisms15

Most common CFTR mutation p.Phe508del (  F508) 3bp deletion (CTT) Deletes phenylalanine at codon % in UK population 66% in world population

Mutation classes Increasing severity in phenotype

Variable splicing of exon 9 DNAExon 8Exon10 Intron 8Intron 9 GTGTG(T)AACAG 5T or 7T or 9T Exon 9

Variable splicing of exon 9 Exon 8Exon 9Exon10 Functional CFTR Exon 8Exon10 Non-functional CFTR 9T 100% 0% 7T 90% 10% 5T 40% 60%

 F508/R117H genotypes  F508/R117H (7T) CBAVD or Pancreatic sufficient CF  F508/R117H (5T) PS CF

Spectrum of CFTR disease Estivill et al Nature Genetics 1996

CF testing at Exeter What referral reasons do we see? What molecular tests do we offer?

Referral reasons Establish or confirm the diagnosis of CF in symptomatic individuals Failure to thrive Chronic cough Persistent chest infections For carrier detection in at-risk relatives and their reproductive partners In prenatal testing of at-risk pregnancies and in which foetal echogenic bowel has been identified Infertility investigations (CBAVD) Sperm and egg donor screening

Molecular testing at Exeter CF1 – detection of p.Phe508del (  F508) by sequencing exon 10 CF33 – detection of panel of 33 different mutations using the Oligonucleotide ligation assay (OLA) OLA product has unique combination of electrophoretic mobility and fluorescence and permits identification of CFTR genotype CF33 OLA Multiplex PCR Ligation Electrophoresis Genemapper analysis

14b a 16 17a 17b Multiplex of 15 PCR reactions 5 6a 6b G XXXX G A XXXXXX A 7 8 Mutant Normal Mutant Normal C C Normal/Normal A XXXXXX G XXXX C T Normal/Mutant T T Mutant/Mutant

R A 1665 W R kb C 1100 R N S R G V I F Q G 1398 G G A R Y AA G G G G 1558 G Patient1 Green 01. Patient1 Yellow 01. Patient1 Blue Normal result

R A 1665 W R kb C 1100 R N S R G V I F Q G 1398 G G A R Y AA G G G G 1558 G Patient1 Green 01. Patient1 Yellow 01. Patient1 Blue F Heterozygous p.Phe508del

R A 1665 W R kb C 1100 R N S R G V I Q G 1398 G G A R Y AA G G G G 1558 G Patient1 Green 01. Patient1 Yellow 01. Patient1 Blue F Homozygous p.Phe508del

“Our inheritance, our future” Realising the potential of genetics in the NHS “The NHS should lead the world in taking maximum advantage of the application of the new genetic knowledge for the benefit of all patients” Genetics White Paper 2003

Investment in genetics 2003 £50 million funding including: £5.5M for gene therapy (including £2.5M for CF) £3.5M to train up to 90 scientists £18M capital to upgrade NHS genetics laboratories

As a result of this investment By 2006, genetic test results should be available: Within 3 days for urgent samples (eg. Prenatal) Within 2 weeks where the potential mutation is known Within 8 weeks for unknown mutations in a large gene All laboratories to secure accreditation with CPA or equivalent within 18 months

Testing strategy – extended CFTR analysis for SCOBEC network Salisbury Exeter Cardiff Bristol Oxford Cambridge  Increased efficiency l rationalisation of tests l introduction of robotics l new IT system  Increased capacity  White Paper reporting times  CPA accreditation  Integration of genetics in pathology £6 million to achieve:

DNA extraction PCRSequencingSequence analysis streamlined Modernisation of Exeter Lab

Reporting time data C E B O C S 3 days for urgent samples 10 days for known mutation 40 days for unknown mutations Salisbury Exeter Cardiff Bristol Oxford Cambridge

Testing strategy – extended CFTR analysis for SCOBEC network

Extended CFTR testing 2. Dosage analysis 1.Sequencing of entire gene (27 exons)

5’ C C T G C A G G C T G G G C G 3’ G G A C G T C C G A C C C G C C T G T G C 5’ DNA Polymerase C C T G C A G G C T C C T G C A G G C T G C C T G C A G G C T G G C C T G C A G G C T G G G C C T G C A G G C T G G G C C C T G C A G G C T G G G C G C C T G C A G G C T G G G C G G C C T G C A G G C T G G G C G G A C C T G C A G G C T G G G C G G A C C C T G C A G G C T G G G C G G A C A C C T G C A G G C T G G G C G G A C A C C C T G C A G G C T G G G C G G A C A C G (a) (b) (c)

CTTCAAG CTTAAG CTTCAAG When you sequence an exon – how do you know how many copies there are? Need a quantitative (dosage) test Partial or whole gene deletions are not detected by sequencing

CFTR deletions and duplications 44 reported out of 1546 CFTR mutations (2.9%) (CF mutation database) a 6b a 14b a 17b Deletion Duplication

MLPA probes PCR primer sequence Y 24 bp sequence specific probes FAM PCR primer sequence X Stuffer sequence P

Annealing of probes PCR primer sequence Y PCR primer sequence X Stuffer sequence

Ligation of probes PCR primer sequence Y A ligase enzyme ligates the 2 probes together – Only annealed probes will be ligated PCR primer sequence X Stuffer sequence

Samples are heated to denature the probe from the DNA

Probe amplification The probe is amplified using the common primer pair

All the probes can be amplified using the same primer pair and PCR conditions

Normal Control CFTR Duplication Exons 6b-10 MLPA Results - Electrophoresis

Normal Control Duplication Exons 6b-10 (Red) Deletion (Blue) MLPA Results – Spreadsheet analysis

Normal Control Duplication Exons 6b-10 Whole gene deletion MLPA Results – graphical display

Testing for CFTR mutations CF4 CF12 CF31 CF33 CFTR entire gene 80% 85% 92.5% 92.5% ~98% mutations

Patient KF 4 year old boy Chest infections Abnormal liver ultrasound ?Cystic fibrosis

Patient KF Routine test for CF Genotype

KF is heterozygous for p.Phe508del

Heterozygous p.Phe508del mutation in KF

Patient KF Request for extended CFTR testing

Referral criteria for extended testing

Guidelines for extended CFTR testing (Sequencing and MLPA £700) Risk factorsAND ≥ 1 phenotypic symptom (recurrent chest infections, pancreatic insufficiency or CBAVD) And/Or +ve NBS (two high IRT’s) And/Or CF diagnosed in a sibling +ve sweat test or two borderline sweat tests And/Or +ve NPD -/- or +/- On 29 – 33 panel mutation screens. If unable to obtain sufficient sweat or NPD unavailable, proceed if ≥ 2 phenotypic symptoms or ≥ 2 of the and/or risk factors Obligate Carrier (Clinical diagnosis of CF in offspring) a) b)

Patient KF Request for extended CFTR testing

MLPA Result for KF Duplication Exons 6b-10 Patient KF KF

Sequencing identified a heterozygous p.Glu585X mutation in KF

Heterozygous p.Glu585X mutation in KF

Results to date Clinical diagnosis CFObligate carrier p.Phe508del/splice site (2) c G>A/splice site p.Phe508del/truncating (3) p.Phe508del/missense (3) c.3067_3072del6 + p.Ile148Thr/missense c kbC>T/missense p.Arg1070Gln/N p.Ile618Asn/nonsense N/N (Pancreatic sufficient) Splice site/NN/N (bronchiectasis x2) p.Phe508del/N (bronchiectasis) Overall pick-up rate 13/18 (72%) Pick up rate 13/15 (87%) excluding bronchiectasis ?CF

Summary  The OLA assay detects 33 CFTR mutations (predict 2 mutations identified in 85% of patients with CF)  Preliminary data suggests that sequencing/MLPA increases detection of 2 mutations to ~96% of patients  Therefore it is not possible to exclude a diagnosis of CF 90% 92.5% 98% 2 mutations81%85%96% 1 mutation18%14%4% 0 mutations1%1%<1%