Making Sense of DNA.

Slides:

Advertisements

Similar presentations

Protein Synthesis.

Advertisements

After today’s lesson you will be able to transcribe a DNA fragment into an RNA fragment and translate the RNA into a polypeptide.

Unit 4 Part I Transcription.

A. There are three key differences between RNA and DNA 1. RNA is single stranded : DNA is double stranded 2. RNA is made of the sugar Ribose – DNA is.

Protein Synthesis Chapter 11.

Section 2 From DNA to Protein

RNA and Protein Synthesis. DNA to RNA to Protein Focus Questions: –How does the message coded in the base sequence of DNA eventually create a protein?

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

A QUICK INTRODUCTION Protein Synthesis. Key Terms Gene RNA mRNA tRNA rRNA Transcription Translation Codon Anticodon Ribosome Denature RNA Polymerase.

DNA StructureDNA Structure  DNA is composed of a chain of nucleotides.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

DNA to Proteins 3-4.

Chapter From DNA to Protein.

Protein Synthesis Translation. DNA (genes) information copied to make  mRNA (transcription) Information in mRNA sequence used to put together  Chain.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA and Protein Synthesis

RNARNA. PROTEIN SYNTHESIS The BIG Picture……. Objective: By the end of class today students will be able to change a DNA sequence into an PROTIEN sequence.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

RNA and Protein Synthesis. How does DNA determine our traits?

RNA AND PROTEIN SYNTHESIS

RNA Another Nucleic Acid.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

DNA to Protein The processes of DNA transcription and translation.

Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.

Structure of DNA DNA is made up of a long chain of nucleotides

A. Chromosomes are made of DNA B.Segments of DNA code for a protein C.A protein in turn, relates to a trait or a gene (examples: eye color, hair color,

YouTube - "The Gene Scene". The Structure of RNA There are three main differences between RNA and DNA. 1. The sugar in RNA is ribose instead of deoxyribose.

RNA Structure and Function. Another Nucleic Acid?? Meet RNA  Monomer: Polymer:  What are some differences between DNA and RNA?

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

RNA A nucleic acid which acts as a messenger between DNA and the ribosomes to carry out the process of making proteins from amino acids. Structure is similar.

I.Structure and Function of RNA A) Why is RNA needed? 1) proteins are made by ribosomes outside the nucleus (on the rough Endoplasmic Reticulum)

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

RNA STRUCTURE TYPES OF RNA TRANSCRIPTION. Learning Targets Students will be able to compare and contrast DNA and RNA Students will be able to identify.

Aim: How are proteins synthesized? What are the main jobs of DNA? Replication & Protein Synthesis.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.

Transcription & Translation. Objectives: Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involved in protein.

DNA to Proteins: Transcription and Translation. Sickle Cell Anemia Video.

Ribosomes and Protein Synthesis

Protein Synthesis Translation.

RNA Another Nucleic Acid.

RNA Another Nucleic Acid.

Do Now: Imagine you have an original Michaelangelo painting

RNA Another Nucleic Acid.

TRANSCRIPTION & TRANSLATION: From DNA to Protein

Chapter 11: From DNA to Protein

RNA and Protein Synthesis

Transcription and Translation

How DNA and RNA make Proteins.

Chp: 12 Transcription & Translation

From DNA to Proteins.

Transcription and Translation

PROTEIN SYNTHESIS.

Nucleic Acids: RNA Ribonucleic Acid: RNA

Protein Synthesis RNA.

Protein Synthesis RNA.

Transcription/ Translation Notes 16-17

Steps of Translation.

How does DNA create action?

Do Now: Imagine you have an original Michaelangelo painting

DNA Replication Living Environment 2015.

Protein Synthesis.

Protein Synthesis.

Protein Synthesis.

PROTEIN SYNTHESIS.

3 July 2019 P. 56 Complete Quick Lab p. 303 Compare and contrast:

Presentation transcript:

Making Sense of DNA

DNA is a code for making proteins DNA (Gene) Protein Trait

Dilemma DNA Contains sequence for protein Risky/Dangerous for DNA to leave nucleus Protein Made by ribosomes Ribosomes stuck in cytoplasm

Solution– SEND MESSENGER!

Step 1- Copy DNA Info on mRNA DNA creates a message for the ribosome called mRNA. Messenger RNA (mRNA): Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)

Step 1- Copy DNA Info on mRNA DNA creates a message for the ribosome called mRNA. Messenger RNA (mRNA): Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) Single stranded

Step 1- Copy DNA Info on mRNA DNA creates a message for the ribosome called mRNA. Messenger RNA (mRNA): Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) Single stranded Uracil replaces all the thymines.

Step 1- Copy DNA Info on mRNA Write the corresponding RNA strand TAAGCTACCGAATGGACAACACTTCGACTA AUUCGAUGGUUACCUGUUGUGAAGCUGA

Step 1- Copy DNA Info on mRNA Transcription video http://www.youtube.com/watch?v=ztPkv7wc3yU Start at 20 sec.

Step 1- Copy DNA Info on mRNA Similarities between DNA and RNA: 1. Sugar and phosphate make up the backbone 2. They both have base pairs 3. They both carry the same protein messages

Step 2- mRNA leaves nucleus

Step 3- mRNA attaches to ribosome at START codon (AUG) Ribosome finds the START sequence in the mRNA: AUG

Remember? Ribosome- ___________________

Remember? Ribosome- makes protein

Step 4- tRNA brings the correct amino acid

Step 4- tRNA brings the correct amino acid Each sequence of 3 bases corresponds to 1 amino acid Codon- sequence of 3 bases that codes for an amino acid

Step 4- tRNA brings the correct amino acid Transfer RNA (tRNA)- brings amino acids to the ribosome.

(Why sequence of 3?) There are 20 common amino acids. Could you make 20 different combinations with 2 bases? How many different combinations can you make with 3 bases?

Step 5- Amino Acids link to form Protein

Step 5- Amino Acids link to form Protein tRNA brings the next amino acid. Peptide bonds- connect amino acids together to form a protein Protein- chain of amino acids that fold into a specific shape.

Step 6- tRNA reaches STOP codon The process continues until the STOP codon: UAG, UAA, UGA Then the protein is complete.

Putting it all together Video 1 Video 2

Ticket How does the DNA code get to the ribosome? Which amino acid would match the mRNA code: CCA?

Short cut

Practice DNA code: TACGTTCGAATT mRNA code: Amino acid code:

Project-Based Assessment #3 Project choices: Cancer (any genes)

MS. HERMAN FARTED !!!!!!