People Graduates Rahul Satija - Footprinting and Statistical Alignment Joanna Davies - Integrative Genomics of Asthma Aziz Mithani - Comparison of Metabolic.

Slides:

Advertisements

Similar presentations

Pre-SIG meeting " Genome Annotation" A BioSapiens initiative Goal of the workshop were - to create an open forum to discuss current problems on function.

Advertisements

Test-tube or keyboard? Computation in the life sciences.

Using bioinformatics for better understanding of genes Becky Seipelt Karla Marriott Arlin Toro Vilma Martinez Roger Lui

CSCE555 Bioinformatics Lecture 3 Gene Finding Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:

Integrating Genomes D. R. Zerbino, B. Paten, D. Haussler Science 336, 179 (2012) Teacher: Professor Chao, Kun-Mao Speaker: Ho, Bin-Shenq June 4, 2012.

 Preparing undergraduates to succeed in college and beyond in a bioinformatics-rich curriculum  Discussion of existing resources, opportunities, and.

BIOINFORMATICS Ency Lee.

JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,

August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.

Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 1 Introduction Aleppo University Faculty of technical engineering.

JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,

Using Bioinformatics to Make the Bio- Math Connection The Confessions of a Biology Teacher.

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

Introduction to BioInformatics GCB/CIS535

Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.

Evolutionary Algorithms Simon M. Lucas. The basic idea Initialise a random population of individuals repeat { evaluate select vary (e.g. mutate or crossover)

BI420 – Course information Web site: Instructor: Gabor Marth Teaching.

Accelerating biology with bioinformatics: collaboration with lab scientists Lewitter, RECOMB BE, July 2011.

The Central Dogma of Molecular Biology (Things are not really this simple) Genetic information is stored in our DNA (~ 3 billion bp) The DNA of a.

Inference of Genealogies for Recombinant SNP Sequences in Populations Yufeng Wu Computer Science and Engineering Department University of Connecticut

Bioinformatics BIO520 Chuck Staben Tom Badgett. Louis XV After me, the deluge.

Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.

Copyright © 2006 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint® Lectures Lectures by Greg Podgorski, Utah State University Are Viruses.

Ran Libeskind-Hadas, Department of Computer Science Thanks to Eliot Bush (Biology) and Zach Dodds (Computer Science) Bioinformatics Education at Harvey.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Databases in Bioinformatics and Systems Biology Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.

Genomics in Drug Organon, Oss Tim Hulsen.

Igor Ulitsky.  “the branch of genetics that studies organisms in terms of their genomes (their full DNA sequences)”  Computational genomics in TAU ◦

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Genomes and Their Evolution. GenomicsThe study of whole sets of genes and their interactions. Bioinformatics The use of computer modeling and computational.

20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.

Molecular Biology Primer. Starting 19 th century… Cellular biology: Cell as a fundamental building block 1850s+: ``DNA’’ was discovered by Friedrich Miescher.

Bioinformatics: Theory and Practice – Striking a Balance (a plea for teaching, as well as doing, Bioinformatics) Practice (Molecular Biology) Theory: Central.

ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

Overview of Bioinformatics 1 Module Denis Manley..

EB3233 Bioinformatics Introduction to Bioinformatics.

An overview of Bioinformatics. Cell and Central Dogma.

Mechanisms for Diversity and Genetics Big Idea #3 In conjunction with Big Idea #2.

Bioinformatics and Computational Biology

Comparative Genomics Methods for Alternative Splicing of Eukaryotic Genes Liliana Florea Department of Computer Science Department of Biochemistry GWU.

What is Bioinformatics?

Bioinformatics Dipl. Ing. (FH) Patrick Grossmann

Computational Biology and Genomics at Boston College Biology Gabor T. Marth Department of Biology, Boston College

Students should “be conversant not only with the language of biology but also with the languages of mathematics, computation, and the physical sciences”

Using DNA Subway in the Classroom Genome Annotation: Red Line.

Recombination and Pedigrees Genealogies and Recombination: The ARG Recombination Parsimony The ARG and Data Pedigrees: Models and Data Pedigrees & ARGs.

Center for Bioinformatics and Genomic Systems Engineering Bioinformatics, Computational and Systems Biology Research in Life Science and Agriculture.

BME435 BIOINFORMATICS.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Bioinformatics Overview

Genomes and their evolution

Gil McVean Department of Statistics

Statistical Applications in Biology and Genetics

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

Genomes and Their Evolution

Genome organization and Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Biological Information and Biological Databases

The Language of genes Su Dong Kim Biointelligence Lab.

Computational Biology Projects

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Hidden Markov Models in Bioinformatics min

9 Future Challenges for Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Recombination, Phylogenies and Parsimony

Introduction to Bioinformatic

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

People Graduates Rahul Satija - Footprinting and Statistical Alignment Joanna Davies - Integrative Genomics of Asthma Aziz Mithani - Comparison of Metabolic Pathways Marton Munz - Comparative Molecular Dynamics Postdocs Rune Lyngsø - computer scientist, RNA and algorithms Istvan Miklos - mathematician, Statistical Alignment Garrett Hellenthal - Geneticist, Association Mapping Shuhei Mano - Mathematical Geneticist Bhalchandra Thatte - Combinatorics Inference of Pedigrees Student Projects Plamen Turmenjev - evolution of cell cycle dynamics Cong Xie - inference of somatic cell phylogeny Stephen Okeefe - MCMC statistical alignment Tian Zuo - MinARGs and Association Mapping Markus Gerstel Evolving English Grammar

Themes: Evolution, Variation and Systems Evolutionary model Unknown ancestral sequences Unknown genealogy Evolution/Homology: Domain Expansion: Systems and Modeling Variation within Species

Focus Recombination Hein, Schierup and Wiuf Gene Genealogies, Variation and Evolution Sequence Evolution & Hidden Structure Genomes

Some Projects Theoretical Projects/Methodology Projects (Taylor, Darden,..) The TPS Algorithm & the Evolutionary Path of Protein Structures Evolutionary Docking of Proteins Difficult Concepts in Systems Biology Alternative Splicing: Functionality, Evolution and Selection Collaboration Projects (Kay Davies, Cookson, Peter Simmonds, Iber, Decode) Computational Promoter Analysis of non-Coding RNAs Population Pedigree Inference from Genomic Data Comparative Virus Annotation Parameter and Sensitivity Analysis for Large System of ODEs Systems Biology (Bela Novak, Engineering Systems Biology of the Cell Cycle Evolving Dynamical Systems

Comments +’s: Oxford is clearly great place Extremely good collaborations and connections can be made -’s: We provide ideas, expertise, discussion, criticism, but are not strong on micro-management A very good project & a very good plan for it should be provided The content of a project could be Theoretical/Mathematical/Algorithmic Software engineering Empirical Collaboration Some idea of yours

Outreach Bioinformatics Days: 2003 Comparative Genomics 2003 Pathogen Analysis 2004 Mathematical Modelling and Systems Biology 2004 Expression Data Analysis 2005 Regulatory Elements in Eukaryotic Genomes 2005 Bioinformatics and Network Biology 2006 Bioinformatics and Protein Science 2006 Computational Problems in Biology 2007 Genetics of Disease Future: Linguistic Models in Biology and Language, Prostate and Breast Cancer Courses: Bioinformatics and Computational Biology (undergrad) 16*60 min DTC LSI & DTC SysBiol (graduate) 12*90 min Part Time MSc Bioinformatics (masters) Lecture Series: 2004 The Human Genome 2005 Beyond the Human Genome 2005 Bioinformatics, Systems Biology and the OMICS 2007 All about Drosophila Future: Major Diseases and the Model Organisms, The Great Genetic Diseases, The Great Infectious Diseases