Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -– Welcome (Nov.

Slides:

Advertisements

Similar presentations

OpenBiblio: an easy-to-use free Integrated Library System software

Advertisements

Copyright © 2006 by The McGraw-Hill Companies, Inc. All rights reserved. McGraw-Hill Technology Education Copyright © 2006 by The McGraw-Hill Companies,

OpenOffice.org 2.2 ● Everything you need in an office productivity suite  Writer - a word processor for creating dynamic documents  Calc - a spreadsheet.

© 2008 Prentice-Hall, Inc.1 Technology in Action.

You can run that from a USB Drive ? Portable Applications: the good, the bad and the ugly Jeff Gimbel © 2007.

Kaitlin Moran Software Brief. What is picnik? Picnik is a free program that allows you to create your photos into a master piece, through a variety of.

26-Jun-15 Getting Ready for CIT Labs Lab is scheduled for 3;00-4:30 Fridays in Moore 207 Lab is not in Towne 309 (Registrar has it wrong) Everyone.

30-Jun-15 Getting Ready for CIT Labs Lab is scheduled for 1:30-3:00 Fridays in Moore 207 Lab is not in Towne 313 (Registrar has it wrong) Everyone.

Free Software Alternatives: Avast! Anti-virus

Objectives Machine language vs.. High-level language Procedure-oriented, object-oriented, and event- driven languages Background of Visual Basic VB Integrated.

2.3.3 Utility Program.  Differentiate between the type and usage of utility programmes (files management, diagnostic and file compression)  Differentiate.

INSTALL CHROMIUM O/S FOR TIWI ISLAND COLLEGE BY NICHOLAS DIAMANDOPOULOS.

 Advantages  Easy to learn  Graphical Advantages  Help and Support  Widely used  Software compatibility  Customisable  Customisable Hardware 

How to use Clickview for your school digital video needsClickview.

Portable Apps vs. U3 Apps on a stick - what's best.

AIM higher with Bookshare! Part 2 1 Welcome! CTEBVI Attendees March 11, 2011.

OPERATING SYSTEMS MAC OS X. Operating Systems : - Windows - Linux - Mac OS X.

Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.

The Basics  Operating systems (OS) can help computer users do many things, like managing and manipulating files and folders.  Operating systems also.

What Bill Gates Doesn’t Want You to Know (aka: Good computer programs for free)

Free Photo Editing Applications On The Horizon: Emerging Learning Technologies October 28, 2010 Marsha Bansberg, Digital Projects Assistant Oberlin College.

Software Essentials ICT 1 & 2. What is software?  software is the set of instructions stored inside a computer  These instructions tell the computer.

Skype Presentation By: B. Hardman Image used from

Python technology Python is a programming language that lets you work more quickly and integrate your systems more effectively. You can learn to use Python.

Using MIRC – RSNA’s Teaching File Software: A Hands-On Course Tessa S. Cook, MD PhD William W. Boonn, MD.

Open Source Project By Robert Smith

Introduction After seeing the pressure of license and proprietary software users where a lot of money is needed to make sure the software is in good condition,

How do I use my Ebooks? Nursing 100 Fall So what’s so great about an Ebook? They are inexpensive Environmentally friendly Lighter to carry Offer.

LINUX Operating System Offered by UBUNTU. Default Application Ubuntu contains a selection of useful applications. In the Applications menu you will find.

Introducing Software Computer Concepts Unit A. Introducing Software What is an Operating System? OS is the master controller for all the activities that.

General rules 1. Rule: 2. Rule: 3. Rule: 10. Rule: Ask questions ……………………. 11. Rule: I do not know your skill. If I tell you things you know, please stop.

Google Apps and Education Jack Nieporte St James of the Valley

CS101 Computer Software. Software Software is... Two main types of software are…

Software Essentials ICT 1 & 2. What is software?  software is the set of instructions stored inside a computer  These instructions tell the computer.

Using RSNA’s Teaching File Software (MIRC): A Hands on Course Mary Wyers, MD.

MIRC in Windows by Byung Lee. mIRC in Windows  What is mIRC?  Requirements for mIRC  Installing mIRC  Setting Up mIRC  Connection  Join a Channel.

Operating Systems. Define OS Operating System is a type of system software. Operating system software includes instructions that allow a computer to run.

Department of Mathematics Technology Orientation.

Welcome to Open Source Technology An Overview of Software By Afroz Hippargi, CIT, YASHADA, Pune.

Browsing Tips Mozilla Firefox. About Firefox Available at Available at Maintained.

VMware Recovery Software RECOVER DATA FROM CORRUPT VMDK FILE.

Desktop Linux 101 Building Presentations with Impress.

Introduction to FOSS. Classes of software  Operating System (OS)  Software that manages all the application programs in a computer  Manages the computer.

10 Questions and Answers about.

U3A in Bath - FOSS group1 Free and Open Source Software Andy Pepperdine 26 April 2012.

Cloud-Computing Cloud Web-Blog Software Application Download Software.

Office 2016 and Windows 10: Essential Concepts and Skills

ITC 4 ESO 3rd TERM Operating Systems YEAR

Using the Personal Image Photo Library

LINUX History In 1984 a project was launched by Richard Stallman to develop a complete Unix-like operating system that would be considered free software.

Macintosh & Linux Used to fill in pg 5 & 6 of “Operating Systems” Packet.

PC Operating Systems in Review

Kurzweil 3000/firefly Information and Procedures

COMP 170 – Introduction to Object Oriented Programming

OPEN SOURCE SOFTWARE (OSS)

Computer Literacy Unit 2

HOW TO INSTALL DRIVERS ON WINDOWS 10. Select the Start button and Go to the device manager.

HOW TO INSTALL DRIVERS ON WINDOWS 10. Select the Start button and Go to the device manager.

Software and Programming

Welcome to Office 365 Launch Event for PT Prasmanindo Boga Utama

CS101 Computer Software.

Different Operating Systems

Software and Programming

Information Technology Services

Student Success and the Impact of Free and Open Source Software (FOSS)

CS101 Computer Software.

Permission for this presentation is currently restricted. If you are not running Microsoft Office 2003 or an application that supports presentations with.

Presentation transcript:

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -– Welcome (Nov. 16, 2009; Library, Natick MA) Who are we? What is FOSS - and who cares? What's it like? Use it on my OS? Add Linux? Share Linux? Who can help me? What next?

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -– Who are we? - Programmers, Advanced computer users, Casual users, Beginners (pick one) - Do you use Windows, Mac OS X, Linux, other? (as many as apply)

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -– What is FOSS - and who cares? - Free, Open-Source Software - If it runs in Linux, it's FLOSS. - Free to use, free to modify - Less cost, less restrictive, less virus

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -- What's it like? Of thousands, let's consider: - Firefox to browse the web (firefox.com) - Thunderbird (mozillamessaging.com) - Open Office (openoffice.org) - The GIMP for image manipulation (gimp.org) - GRAMPS for family history (gramps.project.org)

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -- How can I use it? - Much FOSS runs on Windows and Macintosh. - Or, switch to Linux, a full FOSS system that includes hundreds of FOSS apps and has online libraries with thousands more. - Or, have your computer run its OS and Linux!

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -- Who can help me? - MMS (when it's worth the cost) - Online (linuxtoday.org, freshmeat.org) - Boston Linux-Unix User Group (blu.org) - BLU InstallFest (MIT, 10-5 Dec. 5th, 2009) - Start local meetings?

Dick and Jill Miller of Miller Microcomputer Services (millermicro.com) in Natick, Massachusetts present: -- Free Software That Works -- What next? - Sign up for more FOSS announcements. - Download this FOSS.ppt file (made with OO.o Impress). - Download and use FOSS programs, Linux (ubuntu.com). - Ask Library to sponsor more FOSS events!