Sex determination Jonathan Wolfe

Slides:

Advertisements

Similar presentations

Chromosome Disorders. Classification of genetic disorders  Single-gene disorders (2%)  Chromosome disorders (

Advertisements

Humans: Nature and Nuture

Chapter 11 Germ cells, fertilization and sex

Sex Determination Chromosomal Sex Determination

Current Topics of Genomics and Epigenomics. Outline  Motivation for analysis of higher order chromatin structure  Methods for studying long range chromatin.

Genetics and Development. Embryology & Genetics How did the work of Boveri and Stevens support the chromosomal hypothesis of inheritance? How did the.

Sexually dimorphic gene expression in somatic tissues. Authors: J. Isensee and P.Ruiz Noppinger Center for Cardiovascular Research, Center for Gender in.

Gene Expression I Becky Morrow Tom Torello Nancy Trun Mary Ellen Wiltrout Sarah Woodley.

The Y Chromosome *PAR - Pseudoautosomal region

A turbo intro to (the bioinformatics of) microRNAs 11/ Peter Hagedorn.

14.21 General scheme of development in the vertebrate kidney (Part 1)

27803::Systems Biology1CBS, Department of Systems Biology Schedule for the Afternoon 13:00 – 13:30ChIP-chip lecture 13:30 – 14:30Exercise 14:30 – 14:45Break.

KEY CONCEPT A combination of methods is used to study human genetics.

BIOE 109 Summer 2009 Lecture 4- Part I Mutation and genetic variation.

Genetics of Sex Sex Determination Evolution of Sex Chromosomes

Developmental Genetics, I.How do different cell types become organized into tissues, organs & systems? II.Sex determination in Drosophila III.Sex determination.

William S. Klug Michael R. Cummings Charlotte A

 Genes are found on the X AND Y chromosomes.  Genes that are carried on the sex chromosomes are called sex linked genes.

The Hunt for Chromosomal Determinants of Maleness— A gene mapping story……. The Hunt for Chromosomal Determinants of Maleness— A gene mapping story…….

SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.

The role of the SRY gene in determing sex.

Comparative Genomics II: Functional comparisons Caterino and Hayes, 2007.

BIOL30001 Reproductive Physiology

Development: differentiating cells to become an organism.

THE EVOLUTION OF GENETIC MATERIAL ON THE Y CHROMOSOME AND ITS ROLE IN GENDER DETERMINATION Sam Taylor and Lauren Russell Biology 101H Dr. Jean DeSaix Dr.

Copyright © 2009 Pearson Education, Inc. Art and Photos in PowerPoint ® Concepts of Genetics Ninth Edition Klug, Cummings, Spencer, Palladino Chapter 7.

KEY CONCEPT A combination of methods is used to study human genetics.

Thomas D. Kocher Department of Biology BSCI 338K - Lecture 3 Developmental genetics of sex determination.

The Power of “Genetics” LOSS OF FUNCTION Easy in yeast Difficult in mammals Powerful tool to address roles in developmental or signaling networks Gene.

Lecture 20 – Epigenomics – Animals Lecture 20 – Epigenomics – Animals BIOL 5190/6190 Cellular & Molecular Singal Transduction Prepared by Bob Locy Last.

Human Genetics Chapter 12

A b c Differential Evolution of Regulatory Gene Networks in the Sex Determination of Turtles Tanya Manternach 1, Dr. Nicole Valenzuela 2, Dr. Jennifer.

Homework #2 is due 10/17 Bonus #1 is due 10/24 Exam key is online Office hours: M 10/ :30am 2-5pm in Bio 6.

Chapter 12.5 Sex Determination in Humans AP Biology Fall 2010.

TSC1/Hamartin and Facial Angiofibromas Biology 169 Ann Hau.

7.4 Human Genetics and Pedigrees TEKS 6F, 6H The student is expected to: 6F predict possible outcomes of various genetic combinations such as monohybrid.

Homework #2 is due 10/18 Bonus #1 is due 10/25. The order of Hox genes parallels the order of body parts in which they are expressed Fig

Molecular Evolution of Mammalian Imprinted Genes: testing the theories Dr Mary J. O’Connell: BME Group, School of Biotechnology, DCU,

Do we know it all?. John L. Rinn and Howard Y. Chang Annu. Rev. Biochem

Extending Mendelian Genetics

transformer and Sex determination in Drosophila

Transgenesis with high capacity vectors

KEY CONCEPT A combination of methods is used to study human genetics.

The great variety of possible gene combinations in a

more regulating gene expression

KEY CONCEPT A combination of methods is used to study human genetics.

Nat. Rev. Clin. Oncol. doi: /nrclinonc

KEY CONCEPT A combination of methods is used to study human genetics.

S1 Science Biological Sciences

KEY CONCEPT A combination of methods is used to study human genetics.

Gene duplications: evolutionary role

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Volume 29, Issue 5, Pages (June 2014)

KEY CONCEPT A combination of methods is used to study human genetics.

Start-up for 12/8/14 Complete the word search regarding meiosis terminology. If you are the first person finished, let me know.

Volume 29, Issue 5, Pages (June 2014)

KEY CONCEPT A combination of methods is used to study human genetics.

Volume 8, Issue 1, Pages 9-17 (January 2005)

Human Genetics and Pedigrees

Individual genes exhibit distinct female-enriched expression patterns.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT A combination of methods is used to study human genetics.

KEY CONCEPT A combination of methods is used to study human genetics.

The Power of “Genetics”

KEY CONCEPT A combination of methods is used to study human genetics.

Fig. 3 Sex change involves transition from female- to male-specific expression and gene neofunctionalization. Sex change involves transition from female-

Sex Chromosome Effects on Male–Female Differences in Mammals

International Mouse Phenotyping Consortium (IMPC)

KEY CONCEPT A combination of methods is used to study human genetics.

Presentation transcript:

Sex determination Jonathan Wolfe

Objectives At the end of this lecture you should: know in outline the developmental steps in human sex determination be able to describe the evolution of the mammalian Y chromosome and the SRY gene. be able to describe the roles of the genes SRY, DAX1, and SOX9. Be able to describe the genes involved in sex determination in Drosophila Be able to describe the gene DMRT1 and its relatives

Reading Search here for any of the genes mentioned. Goodfellow, P. N.; Lovell-Badge, R. 1993: SRY and sex determination in mammals. Ann. Rev. Genet Koopman, P.; Gubbay, J.; Vivian, N.; Goodfellow, P.; Lovell-Badge, R. 1991: Male development of chromosomally female mice transgenic for Sry. Nature Wunderle, V. M.; et al. 1998: Deletion of long-range regulatory elements upstream of SOX9 causes campomelic dysplasia. Proc. Nat. Acad. Sci. 95: Jennifer A. Marshall Graves 2002: The rise and fall of SRY Trends in Genetics 18: David Zarkower 2001 Establishing sexual dimorphism: conservation amidst diversity? Nature Reviews Genetics Peter Koopman and Kelly A. Loffler, 2003, Sex Determination: The Fishy Tale of Dmrt1 Current Biology, 13: R177 - R179 Haag ES, Doty AV (2005) Sex Determination across Evolution: Connecting the Dots. PLoS Biol 3(1): e21

Comparison between Drosophila and Humans karyotypeDrosophilaHuman 2A XXfemale 2A XYmale 2A XOmalefemale 2A XXXfemale 2A XXYfemalemale

Gonadal differentiation

Y chromosomal genes

Genomic structure of SRY genes

Evolution of the Y chromosome and SRY

The loss of Y chromosomal genes

Sex determination in Drosophila

Another human gene

DMRT1 expression

Chicken Z = Human chr.9

DMRT1 expression in alligator