tch?v=XuUpnAz5y1g&featur e=related

Mastery Quiz 3.01-B

Title Date U4-17 DNA Technology

Gel Electrophoresis DNA Fingerprinting Working with and fingerprinting DNA.

How is DNA used to identify people or organisms? How do we make a DNA Fingerprint? The simplified steps. Write all of this down. 1. Collect DNA evidence. 2. Extract DNA from subject or evidence. 3. Cut the DNA with enzymes. 4. Separate the DNA sections with gel electrophoresis. 5. Compare the gels (DNA fingerprints).

DNA extraction What has DNA? Living things or even recently living things.

Cutting the DNA Restriction enzymes will cut the DNA at special spots in the DNA. Hundreds of restriction enzymes each cut DNA at a different spot. CTTC GAAG One restriction enzyme cuts DNA like this. TTGCTTCTGCTAACATCGATCTTCAGCTAC AACGAAGACGATTGTAGCTAGAAGTCGATG

Separate the DNA pieces. We have many different sized pieces in one test tube. Add some dye. Put the DNA into the well of a gel plate. Put the gel plate in an electrophoresis chamber. Turn it on. But how does it work?

Gel Electrophoresis As electricity flows through the gel it pulls the DNA with it. The bigger the DNA piece the slower it moves. Big pieces Small pieces

Gel Electrophoresis

Compare the DNA of different gels. Evidence Suspect 1 Suspect 2

Baby Mother Father Compare the DNA of different gels.

Baby Mother Father Compare the DNA of different gels.

Baby Mother Father Compare the DNA of different gels.

Uses for DNA Fingerprinting. Write all of this down. 1. Genetic Counselors Detecting Genetic Disorders 2. Paternity Testing Who’s the baby daddy? 3. Crime Scenes Who done it? 4. Evolutionary Relationships Who are our closest evolutionary relatives?

Who should have your DNA? o The government has a database of real fingerprints. o Should the government have a data base of DNA fingerprints? o What is the difference? o Should they collect DNA from everyone?

Would you want to know? If there was a way to find out if you were more likely to get cancer than someone else, would you want to know? What tests would you need to perform? What information would you need to gather?

The Human Genome Project The Human Genome Project A written version of a human genome letters. Write all of this down Discovered over 3 billion base pairs. At 12 font single spaced over 3 boxes of copy paper.

The Human Genome Project Scientists made a map of the entire human genome, every A, T, G, and C >98% of human genome does not code for proteins Is there one map for every human? Now there is a database of genes. We still don’t know what all the genes do. What do genes do? Code for proteins.

The Human Genome Project Does Bob have a genetic disorder that runs in his family? Now we can just look at his genes to see.

The Human Genome Project Breast Cancer has been linked to certain genes. Women can now get a screening for this gene to see if they are susceptible to getting breast cancer.

Gene Therapy W Write all of this down. Fixing or adding genes to all cells in the body with viruses.

Viruses - A tool for gene therapy. Non living things with genes inside. They inject DNA into a cell.

What is Gene Therapy? If a gene is defective or missing then a problem results. If the gene is identified then it can possibly be fixed. (the reason for the human genome project) Viruses with the missing gene inside can be injected into the person with the missing gene. The Viruses infect cells and inject the gene. Now the person has good copies of the gene. This can cure a disease.

Viruses - A tool for gene therapy. Could we change a person’s genes this way? Would you?

Human Genome Project Ethics Essay 4 paragraphs – over one and a half pages long, hand written. 4 paragraphs – one full page typed. Par. 1 - What is the human genome project? How has this project/discovery enabled this ethical debate to be an issue? How do we now have the power to do what is stated below? Par. 2 - What positive outcomes could result of going through with the issue? Par. 3 - What negative outcomes could result of going through with the issue? Par. 4 - What is your stand or opinion on the issue and why? Would you do it? OR

Ethical Questions If you could customize your child e.g. boy or girl, eye color, height, intelligence, physical strength, would you? Super Race? X-Men? If you knew your child had a genetic disorder that would result in a very short life or a poor quality of life, would you still have the child? Abortion or Adoption? Should other people like the police have access to your genetic information? Should insurance companies or employers have access to your genetic information? Should your doctors have a copy of your genome? Should we use gene therapy to cure diseases? “I am Legend”