Post-Golgi biosynthetic pathways

Slides:



Advertisements
Similar presentations
Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Advertisements

Receptor-Mediated Endocytosis experimental pathway ( II ) Wu Chenzi.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Ch. 5. Cytoplasm   Figure 5.10 Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings.
The Nucleus Nuclear Organization Nuclear Envelope and Molecular Trafficking Nucleolus and rRNA Processing The nucleus is one of the main features that.
MOVEMENT ACROSS MEMBRANES
Last Class: 1. transportation at the plasma membrane A. carrier protein, B. channel protein 2. intracellular compartments A. nucleus, B. Endoplasmic Reticulum.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Endocytosis and Lysosome Formation The Endolytic Pathway.
Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.
Lecture 11 Vesicular Trafficking: Lysosomes;
Vesicular Traffic II. Endocytic and secretory pathways red = secretory green = endocytic blue = recycling.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Lecture 3 Vesicular Trafficking -Cops and Clathrins -Arfs, Rabs, Sars -Snares.
Protein trafficking between membranes By Graham Warren & Ira Mellman
Endoplasmic Reticulum
SNAP-23, syntaxin-3 (t) VAMP-7 (v) VAMP-8 (?) Annexin 13B
Golgi Apparatus Lecture 10, Cell Biology. Discovery of Golgi body  The Golgi apparatus is noticeable with both light and electron microscope. It is also.
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Introduction Question How are the high-molecular- weight yolk (卵黄) proteins able to enter the oocyte( 卵母细胞 )?
Post-Golgi biosynthetic pathways. MDCK-cell Resting fibroblast Migrating fibrobl. The epitelial cell line MDCK is the most studied model system for polarised.
Endocytosis & Exocytosis Pooja Patel Elizabeth Pemberton.
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
Membrane Functions Transport Systems Enzyme Systems
The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)
Vesicle Formation at the Plasma Membrane and Trans-Golgi Network: The Same but Different M. A. McNiven, et al., Science 313, 1591 (2006) Department of.
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 14 Vesicular Traffic, Secretion,
Molecular and Cellular Biochemistry 2. ER- protein modifications
TGN SNAP-23, syntaxin-3 (t) VAMP-7 (v) VAMP-8 (?) Annexin 13B MAL 17 Protein kinase D NSF,  -SNAP, syntaxin 4(?), SNAP 23, VAMP (toxin sensitive), cdc42.
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Integral Proteins Some transmembrane transport proteins are porins that form aqueous channels through membranes Some integral proteins anchored to the.
Functions of the plasma membrane 1.Holds the cell together 2.Controls what goes in and out (diffusion, osmosis, active transport) 3.Protects the cell.
Receptor-Mediated Endocytosis As Presented By Michael Chan.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
Cell Membranes.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Secretion, Exocytosis & Endocytosis Lecture 22BSCI 420,421Oct 23,24, 2002 An old Cherokee told his grandson about a battle going on within him. “It is.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Vesicular Transport Pages The general flow of membrane enclosed material within cells.
Vesicular Trafficking Movement From the ER Through the Golgi.
Lecture 12: The secretory pathway
The ER and Golgi Modify & Sort Proteins
glycosylation is a non-template derived phenomenon
Active Transport Processes
Protein Sorting & Transport
Membrane Structure & Function
Vesicular Trafficking
Exocytosis, Endocytosis, Endosomes and Lysosome Formation
The Endomembrane system
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Conference on the Endocytosis
Intracellular Compartments and Transport 2
MOVEMENT ACROSS MEMBRANES
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
The Cell Chapter 6.
Endocytosis and Signaling
CELL MEMBRANE FUNCTION
Volume 62, Issue 3, Pages (September 2002)
Membrane Dynamics in Endocytosis
Ayman El-Sayed, Hideyoshi Harashima  Molecular Therapy 
Endocytic trafficking of CFTR in health and disease
Renal albumin absorption in physiology and pathology
Lysosomes and endocytic pathways
Chapter 13 Intracellular Vesicular Traffic.
Cell Membrane notes.
Neuronal Polarity and Trafficking
Presentation transcript:

Post-Golgi biosynthetic pathways

MDCK-cell Resting fibroblast Migrating fibrobl. The epitelial cell line MDCK is the most studied model system for polarised sorting and transport.

Hepatocyte Retinal pigment Retinal rod cell epitelial cell

Hippocampus neuron Osteoclast Budding yeast cell

Sorting along the biosynthetic pathway in epitelial cells Sorting along the biosynthetic pathway in epitelial cells. MDCK-cells as model system. Sorting in the trans-Golgi network. THE SORTING DEPENDS ON SIGNALS IN THE MOLECULES TO BE SORTED

Classical signals: *Sorting of lysosomal enzymes to lysosomes *Basolateral transport in epithelial cells. *Retrograde transport from the Golgi to ER. *Endocytosis of receptors and other molecules from the cell surface – a fraction is sorted to the trans-Golgi network.

Before any basolateral sorting signals were identified (1991 ->), it was suggested that basolateral transport occured by “bulk flow” while transport to the apicale side – which is the specialised domain in epithelial cells – would require sorting. In 1991 it was published, however, that the transmembrane protein pIgA receptor was transported basolaterally in a signal dependent manner.

Growth of MDCK epitelial cells on filters Growth of MDCK epitelial cells on filters. Transfer to glass-dishes with 90 ml of medium for establishment of confluent cell layers.

Apikalt medium Basolateralt medium

Cytoplasmic domain Baso Api Lumenal domain tm

BASOLATERAL SORTING SIGNALS Some basolateral sorting signals overlap with endocytosis signals. *Fc receptor *Asialoglycoprotein receptor *Lysosomal acid phosphatase Other basolateral sorting signals are distinct from endocytosis signals. *Polymeric IgA receptor *LDL receptor *Transferrin recptor (?)

CT12 CT22 lys-asn-trp-arg-leu-lys-asn-ile-asn-ser-ile-asn-phe-asp-asn-pro-val-tyr-gln-lys-thr-thr-glu-asp- glu-val-his-ile-cys-his-asn-gln-asp-gly-tyr-ser-tyr-pro-ser-arg-gln-met-val-ser-leu- glu-asp-asp-val-ala-COOH CT27 CT37 PM Wild-type Basolateral CT37 Basolateral CT27 Basolateral CT22 Apical CT12 Apical, no endocytosis tyr 18 => ala, wt Basolateral, no endoc. tyr 18 => ala, CT37 Apical, no endoc. tyr 18 => ala, CT27 Apical, no endoc.

Conclusion: There is a tyrosine based basolateral sorting signal in the same region as an endocytosis signal. In addition, there is a second basolateral sorting signal further away from the membrane, outside CT27. This sirting signal has the largest capacity for basolateral sorting (overexpression studies). With this part of the tail alone, a mutation tyr 35 => ala gives 70 % apical receptor. Mutation of both tyr 18 and tyr 35 in wt gives 95 % apical receptor.

YXX (YVEL/YTDI/YXRF) PXXP LL / IL / LEL NPXY YKYSKV YXRF H/R-XXV

Annexin II, Annexin XIIIb

The adaptins consist of 2 large, 1 medium and 2 small subunits. The first proteins regarded as mediators of basolateral sorting were adaptins – already known to be involved in endocytosis from clathrin coated pits at the cell surface. The adaptins consist of 2 large, 1 medium and 2 small subunits. 4 different adaptin-complexes have been discovered. AP-1A: TGN AP-1B: Epithelia specific AP-3A: Endosome/TGN AP-3B: Neuron-specific (endosome?)

AP-1, AP-2 and maybe AP-3 (in mammals) may bind clathrin. Exchange of material between the TGN, endosomes, lysosomes and the plasma membrane is mediated largely by carriers with a dense protein coat regarded to be necessary for selection of content and pinching off from the donor membrane. AP-1, AP-2 and maybe AP-3 (in mammals) may bind clathrin. All 4 complexes are found in Arabidopsis, but only AP 1-3 in Drosophila. Many of the subunits are found as closely related isoformes coded by separate genes making a large number of combinations possible. Endocytosis

AP-1B contains a specific 1B subunit which only is expressed in certain polarised cells (not all polarised cell types, mainly epithelia). Recognizes tyr-based signals. AP-4 has also been connected to basolateral sorting, but has equal or overlapping specificity with AP-1B. There is still room for more adaptors for basolateral sorting. AP-4 Somewhere in the picture: FAPP1 and FAPP2, mediating TGN => PM transport.

GGA (1-3): Golgi-associated, -adaptin homologous, ARF-interacting proteins N-terminal hydrofobicsequence ARF-1 GDP GEF Rabaptin 5 binding Ear = GAE Ubq -synergin? What about tyr-signals? AP-1

At least 6 ARFs exist in mammals, 5 are localised to the Golgi-apparatus and 1 to the plasma membrane. Aktiv membranbundet ARF1-GTP (myristoylated), a tyrosine based signal, and phosfatidylinositol 4,5 bisphosphate are necessary to recruit AP-1 clathrin adaptors to membranes. cytoplasmatisk 4 families GEFs with several members Phosphatidylinositides of the 4-series has been regarded as important for Golgi.

GGA dependent receptors CI-Mannose-6-phosphate receptor CD-Mannose-6-phosphate receptor Sortilin SorLA/LR11 LRP-3 -secretase

All mechanisms for sorting from the TGN are not known *We have only discussed proteins with one transmembrane domain, while many proteins span the membrane several times. These may also be sorted. How? *Some apical proteins, like megalin, have been reported to have signals in the cytoplasmic tail (not only luminal signals). *Ubiquitinylation may shift the sorting from TGN to the plasma membrane towards TGN to lysosomes (the vacuole in yeast) by changing the surrounding circumstances. *Lipids may play a role in sorting in many ways. *What factors are necessary for budding, transport and fusion?

APICAL SORTING IN EPITHELIAL CELLS Glycans: N-glycans, O-glycans, glycosaminoglycans Yes (maybe and no), yes (maybe), yes. GPI-anchors? NOT REALLY LIPID DOMAINS?? Protein motifs for apical sorting: Megalin NPXY. The second of three NPXY motifs is crucial.

MDCK cells transfected with the gene for the non-glycosylated protein rat growth hormone (rGH) secretes this protein randomly, which is slightly more basolaterally rGH with 2 N-linked glycosylation sites is secreted almost exclusively into the apical medium.

Erythropoietin – three N-glycans, one is critical. Endolyn – eight N-glycans, not all equally important. O-glycans of mucin type may also mediate apical sorting: Intestinal sucrase-isomaltase Gp-40 Several other examples But several examples of non-sorted glycoproteins also exist.

CS HS

a h c b h c c h c sulfate S apical basol cell Cys/met

Detergent insoluble proteins of apical transport vesicles were separated by 2D-gel analysis and sequenced. One putative lectin molecule was found: VIP 36. Hypothesis VIP 36? A raft Transmembrane lectin-molecule

Could Versican do this?? Versican is reported to bind to sulfated glycolipids*. Could this happen in the Golgi lumen? If yes, is this attachment of any importance for biosynthesis or sorting of Versican? *Miura, Aspberg et al. 1999 raft Could the N-term bind other than hyaluronic acid?

WHAT IS A (GLYCOLIPID) RAFT? Glycolipid- and cholesterol rich domains in a lipid membrane are associated in a more stable structure than lipids are according to “the fluid mosaic model.” On the cell surface of a “regular” cell, these domains will have a diameter of 60 - 100 nm. In specialised membranes may larger areas of the plasma membrane have raft-characteristics. Example: The apical membrane of epithelial cells (MDCK). Do lipids and lipid-binding proteins play a role in sorting of molecules that are transported from the TGN to the apical membrane?

Caveolins: Proteins with affinity for specialised lipid-domains Caveolins: Proteins with affinity for specialised lipid-domains. Palmitoylation. Might be necessary for transport of GPI-anchored proteins to the cell surface. GPI-anker: Glycosyl-phosphatidyl-inositol-anchor that might bind proteins to a membrane. For some time regarded as sorting signals for apical transport, since these proteins usually are localised to rafts. The apical sorting is most likely dependent on N-glycans (via transcytosis?). Glycosphingolipids: are glycolipids that are mainly transported to the apical side in MDCK-cells (from the TGN). Present in rafts rich in cholesterol. MAL (VIP 17): A protein that seems to mediate apical sorting of several cargo proteins in MDCK-cells.

There are probably several independent transport mechanisms operating in parallell, both to the apical and to the basolateral side of MDCK epitelceller. The apical ones may be raft-based or not raft-based.