AC CNR ACCNR 15 DPA B+7 A: 35 members E: 19 members B: 21 members C: 10 members D: 138 members F: 20 members G: 109 members H: 87 members I: 20 members.

Slides:

Advertisements

Similar presentations

Human impact on the environment In this lesson you will learn about: the biological control of pest species the use of GM crops as an alternative to using.

Advertisements

Control of Gene Expression

44 D (3 Khipu elements) Phaseolus vulgaris B4 locus 410 Kb contig 158 kb Sub- cluster C 400 Kb 300 Kb 250 Kb 200 Kb 150 Kb 100 Kb 50 Kb

Fruit Firmness Stewart Dalton. The issue Blueberries have a short post-harvest life It does not take long before they become soft and “mushy” Most people.

GO-Slim term : ProcessCluster frequency total proteinsCluster frequencyGenes annotated to the term regulation of biological process 321 out of 1261 genes,

Cytoplasmic regulation lifetime localization initiation.

1 The Lac Operon 1961, Jacob and Monod E. coli and other bacteria Bacterial Genes Many genes constitutively expressed “housekeeping” genes Other genes.

Chapter 16 (Part 3) Fatty acid Synthesis.

ENZYME CLASSIFICATION EXERCISE (1) GLUCOSE + ATP  GLUCOSE-6-PHOSPHATE + ADP + H + (2) CH 3 CH 2 OH + NAD +  (CH3)CHO + NADH + H + (3) ATP + H 2 O  ADP.

Lim et al, Supplemental Figure S Arsenic Plant height (Cm) As[μM] b/c g f e d c/d a/b a c/d a a/b Cadmium

Biology Project Overview Comparisons of GAPC Gene Organization in Plants.

WT L2 L3 L4 L5 L6 L15 L21 L23 L2 L5 L7 L8 BnSTM BrSTM BoSTM AtUBQ10 B A Supplementary Fig. 1 C WT L2 L3 L WTL2L5L7L WTL5L6L15L21.

Anusorn Cherdthong, PhD Applied Biochemistry in Nutritional Science E-learning:

Tel1: TcChr9-PGroup I HP*HP RNA pol IIIHP 8kb 1 Telomeric RepeatRHS* RHSBRCA2N-Acetiyltransferase*RNA helicase*ASF-1ATPaseSIRETS*TSVIPER/SIREL1TcVIPER/SIRERHS*DGF-1Phosphate.

Transcriptome sequencing - a case study in Piper

Processing Function Terms Amelia Ireland. Function Problems Function-process crossover  Function and process are not orthogonal  Functions appear in.

SHC p13.3 SHC (Src homology 2 domain containing) transforming protein 2 CDC p13.3cell division cycle 34 GZMM p13.3granzyme M.

HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.

Supplemental Figure 1S. Alignment and phylogeny of CRY proteins. Comparison of the amino acid sequences of the DNA-photolyase domain (a) and FAD binding.

1 Protein Crystallography. 2 Ban, N., Nissen, P., Hansen, J., Moore, P. B., Steitz, T. A. Science 289 pp. 905 (2000)

A b Cell Cycle c Proliferation KINASE A ANCHOR PROTEIN CASPASE 3, APOPTOSIS-RELATED CYSTEINE PROTEASE NUCLEAR RECEPTOR SUBFAMILY 3, GROUP C, MEMBER 1 BRUTON’S.

Supplemental Fig. S1 extracellular (P=0.000) cell wall (P=0.000) ribosome (P=0.001) ER (P=0.294) golgi apparatus (P=0.005) plasma membrane (P=0.000) mitochondria.

Oxidative phosphorylation pathway Lecture 15 Modified from internet resources, journals and books.

Glycopeptide MS/MS Spectra Supplemental Data 2. gi| Vacuolar invertase 1 [Gossypium hirsutum] R.LFLFNNASGVNVK.A + Deamidated (NQ)

Figure S1. Effects of AVG, DIECA, DPI, NMMA, STA, and OKA on IbRPK expression in sweet potato (Ipomoea batatas cv. Tainung 57). Leaves with petiole cuts.

Takashi Akihiro, Sayo Yoshikawa, Katsuhiko Sato, Tatsuhito Fujimura Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba.

MiRNAPredicted targetsPutative function of targets miRC1GRMZM2G029833_T01DNA binding / DNA-directed RNA polymerase miRC4 GRMZM2G171796_T01; GRMZM2G355906_T03;

Transgenic Approach for Abiotic Stress Tolerance.

Transcription and Translation: What does a cell (or organism) do with its genes??

Complete list of LC-MS myc interating protiens in the MCF7 cells, proteins highlighted in red are those differentially expressed from the LCC1 and LCC1.

LATE BLIGHT RESISTANCE PROTEIN RPI-BLB26 6 NBS-LRR RESISTANCE PROTEIN-LIKE PROTEIN6 LATE BLIGHT RESISTANCE PROTEIN RPI-BLB26 6 LATE BLIGHT RESISTANCE PROTEIN.

First selection: transformation Plating on plate with Km Cultivation in liquid medium with Km until the cells reach the stationary phase Second selection:

GO-Slim term Cluster frequency cytoplasm 1944 out of 2727 genes, 71.3% 70 out of 97 genes, 72.2% out of 72 genes, 86.1% out.

0 Dpa Control pI 4-7 (Linear) 170 kDa Biotic stress pI 4-7 (Linear) 170 kDa kDa

Supp Fig. 1. Protein numberScores (>28=p

No.ClonePutative functionAccessionE -valueNo.ClonePutative function Accession number E valueNo.ClonePutative functionAccessionE -value Forward library.

Comparative Transcriptomics as a Gene Discovery Tool in Solanum pennellii, a Potential Source of Biogasoline Tom McKnight, Sachi Mandal, Wang Ming Ji,

CCAGTTGCCGCGTTCACCCTCTCCTCATCCGCGGTTCACCGGCCTCGTTGAGACTGCCTG  SCO0033 GGCCGTCATTCCGACAGCACCCACGTCTCACTCCCCGTGCCCATGCGGGGACCGGGCGGC CCGGCAGTAAGGCTGTCGTGGGTGCAGAGTGAGGGGCACGGGTACGCCCCTGGCCCGCCG.

Enzymes: Basic concepts

MYCOBACTERIUM TUBERCULOSIS PROTEOME M. tuberculosis- intracellular pathogen - TB prevalent in Africa and Asia - 1/3 population is infected - 8 million.

Protein. Protein and Roles 1: biological process unknown 1.1 Structural categories 1.2 organism categories 1.3 cellular component o unlocalized.

Gene Ontology TM (GO) Consortium

Plant Genomes Houses of genetic materials Total genetic material within a cell Usually referred to a haploid cell [Basic set of genetic material (1x)]

Table S10. A set of 140 Genes differentiating DF vs DHF (HG-U133 plus2 platform) Probeset IDGene SymbolGene Title p-value(DF vs. DHF) Fold- Change(DF vs.

M.Prasad Naidu MSc Medical Biochemistry, Ph.D.Research Scholar.

“noisy” signal analysis

S2 Supporting information: RT-qPCR experiment

Supplementary Material

UNIVERSIDADE ESTADUAL PAULISTA FACULDADE DE CIÊNCIAS AGRONÔMICAS

Human impact on the environment

Chapter 7 Enzyme Mechanisms.

(A) rRNA (B) OsAGPL3 rRNA (C) Time after transfer （h）

Biochemistry of thyroid hormones

Metabolism 1: Catabolism

Down-regulated genes in evolved normomutable variants

Suppl 4A Large black circles: query genes

Classes of Enzymes According to chemical reaction

Chapter Three: Enzymes

HC70AL Final Presentation

Human impact on the environment

Eukaryote Regulation and Gene Expression

Purposes: To demonstrate the tendency of proteins to become longer with increase of organism complexity To study domain architecture of proteins and to.

Volume 4, Issue 1, Pages (January 2011)

Volume 107, Issue 1, Pages 1-3 (October 2001)

Consequences of membrane protein overexpression in E. coli.

Why Have Organelles Retained Genomes?

Nutrient Sensing, Metabolism, and Cell Growth Control

Volume 2, Issue 5, Pages (September 2009)

Putative Simplified Model of Metabolic Pathways Responsible for TAG Accumulation.Upregulated proteins detected by proteomic analysis are illustrated in.

Presentation transcript:

AC CNR ACCNR 15 DPA B+7 A: 35 members E: 19 members B: 21 members C: 10 members D: 138 members F: 20 members G: 109 members H: 87 members I: 20 members

ACCNRACCNR 15 DPA B+7 Accession numberFirst BLAST hitE value gi| |gb|AAD | gi| |emb|CAE | gi|119714|sp|P13983| gi|629719|pir|S33209| gi| |gb|AAQ | gi| |pir|S68805| gi| |sp|P14280| gi| |sp|P09607| gi|129939|sp|P05117| expansin precursor [Lycopersicon esculentum] expansin-like protein [Quercus robur] Extensin precursor (Cell wall hydroxyproline-rich glycoprotein) extensin-like protein precursor - potato pectate lyase [Malus x domestica] pectin acetylesterase (EC ) precursor - mung bean Pectinesterase 1 precursor (Pectin methylesterase 1) (PE 1) Pectinesterase 2 precursor (Pectin methylesterase 2) (PE 2) Polygalacturonase 2A precursor (PG-2A) (Pectinase) 1.1E E E E E E E E-11 3E gi|398992|sp|P05116| gi| |gb|AAM | gi|399007|sp|P28032| gi|19172|emb|CAA | gi|629670|pir|S39508| gi|119640|sp|P10967| gi|585777|sp|P38546| gi|384332|prf| A| gi|124701|sp|P29000| gi| |pir|T06352| gi|585420|sp|P38416| gi|19399|emb|CAA | gi| |ref|NP_ | gi| |pir|S22474| gi|585746|sp|P08196| gi| |dbj|BAB | 1-aminocyclopropane-1-carboxylate oxidase 1 (ACC oxidase 1) (Ethylene-forming. ACC oxidase [Solanum tuberosum] Alcohol dehydrogenase 2 alcohol dehydrogenase [Lycopersicon esculentum] alcohol dehydrogenase homolog, ripening-related - tomato (fragment)" E8 protein; 1-aminocyclopropane-1-carboxylate oxidase homolog GTP-binding nuclear protein RAN1 invertase invertase (ACID BETA-FRUCTOFURANOSIDASE PRECURSOR) lipoxygenase (EC ) - tomato Lipoxygenase B mutant phytoene synthase [Lycopersicon esculentum] pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] phytoene synthase (EC ) - tomato Phytoene synthase 1, chloroplast precursor (Fruit ripening specific protein pTOM5)" putative t-SNARE SED5 [Oryza sativa (japonica cultivar-group)] 7.7E E E E-37 1E E-57 2E E E E E E-68 9E E-66 1E-103 A B C

gi|585778|sp|P38547| gi| |gb|AAG | gi| |gb|AAC | gi| |ref|NP_ | gi| |sp|Q43513| gi| |dbj|BAB | gi| |ref|NP_ | gi| |sp|P09607| gi|136057|sp|P21820| gi| |ref|NP_ | gi| |gb|AAP | gi| |sp|P48495| gi| |gb|AAM | gi| |ref|NP_ | gi| |sp|P14280| gi| |sp|Q9SWF5| gi| |pir|T07602| gi| |gb|AAM | gi| |emb|CAB | gi| |pir|T03934| GTP-binding nuclear protein RAN2 ripening regulated protein DDTFR8 [Lycopersicon esculentum] chaperone GrpE type 2 [Nicotiana tabacum] expressed protein [Arabidopsis thaliana] Metallothionein-like protein type 2 putative senescence-associated protein [Pisum sativum] rubber elongation factor (REF) family protein [Arabidopsis thaliana] Pectinesterase 2 precursor (Pectin methylesterase 2) (PE 2) "Triosephosphate isomerase, cytosolic (TIM)" stress enhanced protein 2 (SEP2) [Arabidopsis thaliana] calmodulin [Pyrus communis] "Triosephosphate isomerase, cytosolic (TIM)" unknown protein [Arabidopsis thaliana] mitochondrial substrate carrier family protein [Arabidopsis thaliana] Pectinesterase 1 precursor (Pectin methylesterase 1) (PE 1) Adenosylhomocysteinase (S-adenosyl-L-homocysteine hydrolase) (AdoHcyase) heat shock protein tomato glyceraldehyde 3-phosphate dehydrogenase [Solanum tuberosum] glyceraldehyde-3-phosphate dehydrogenase [Nicotiana tabacum] DNA binding protein ACBF - common tobacco 2.7E E-14 4E E E E E E E E E E E-44 3E E E-09 1E E-95 G F Accession numberFirst BLAST hitE value ACCNRACCNR 15 DPA B+7 gi| |ref|NP_ | gi| |ref|NP_ | gi| |ref|NP_ | gi| |ref|NP_ | "glyceraldehyde 3-phosphate dehydrogenase, cytosolic, putative / NAD-dependent gl. "transcriptional regulator, MerR family [Shewanella oneidensis MR-1]" epimerase-related [Arabidopsis thaliana] expressed protein [Arabidopsis thaliana] 2.4E E E E-87 gi|129939|sp|P05117| gi| |dbj|BAC | gi| |sp|P51850| gi|585420|sp|P38416| gi| |ref|NP_ | gi| |gb|AAM | gi| |gb|AAM | gi| |ref|NP_ | gi| |pir|T50822| gi| |ref|NP_ | gi| |gb|AAN | gi| |ref|NP_ | gi| |pir|T07425| gi|384332|prf| A| gi| |sp|O04973| gi| |sp|P80471| gi| |pir|T06406| gi| |pir|S61425| gi| |ref|NP_ | gi| |gb|AAO | gi|124701|sp|P29000| gi| |gb|AAL | gi| |dbj|BAC | gi| |gb|AAD | gi|119640|sp|P10967| gi| |ref|NP_ | gi| |ref|NP_ | gi| |gb|AAG | gi| |ref|NP_ | gi| |ref|NP_ | gi|629670|pir|S39508| gi| |gb|AAM | Polygalacturonase 2A precursor (PG-2A) (Pectinase) monooxygenase [Solanum tuberosum] Pyruvate decarboxylase isozyme 1 (PDC) Lipoxygenase B "monooxygenase, putative (MO2) [Arabidopsis thaliana]" putative dehydrogenase [Arabidopsis thaliana] putative DNA polymerase delta small subunit [Arabidopsis thaliana] ATPase component ABC-type dipeptide/oligopeptide/nickel transport system [Nitros. "ribosomal protein S26, cytosolic [imported] - garden pea" zinc finger (Ran-binding) family protein [Arabidopsis thaliana] acyltransferase 2 [Capsicum chinense] zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] phosphoinositide-specific phospholipase C (EC ) plc3 - potato invertase 2-isopropylmalate synthase A (Alpha-isopropylmalate synthase A) (Alpha-IPM synthe. "Light-induced protein, chloroplast precursor (Chloroplastic drought-induced stress p. ripening protein E8 homolog - tomato "inorganic diphosphatase (EC ), H+-translocating (clone TVP17), vacuolar m. zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] putative developmental protein [Nicotiana benthamiana] Acid beta-fructofuranosidase precursor (Acid sucrose-6-phosphate hydrolase) (Acid i. minor allergen beta-fructofuranosidase precursor [Lycopersicon esculentum] vacuolar processing enzyme-1b [Nicotiana tabacum] ethylene-responsive transcriptional coactivator [Lycopersicon esculentum] 1-aminocyclopropane-1-carboxylate oxidase homolog (Protein E8) translation initiation factor 3 (IF-3) family protein [Arabidopsis thaliana] "phototropic-responsive protein, putative [Arabidopsis thaliana]" putative glutathione S-transferase T4 [Lycopersicon esculentum] expressed protein [Arabidopsis thaliana] "oxidoreductase, 2OG-Fe(II) oxygenase family protein [Arabidopsis thaliana]" "alcohol dehydrogenase homolog, ripening-related - tomato (fragment)" unknown [Arabidopsis thaliana] 3E E E E E E E E E E E-60 1E-53 2E E E E E E E E E E E E E E E-22 gi|585777|sp|P38546| gi| |gb|AAP | gi| |dbj|BAC | gi|585746|sp|P08196| gi| |ref|NP_ | gi| |ref|NP_ | gi| |ref|NP_ | gi| |gb|AAF | gi| |gb|AAL | gi| |sp|Q40519| gi|629669|pir|S39507| gi| |gb|AAG | GTP-binding nuclear protein RAN1 auxin response factor-like protein [Mangifera indica] hypothetical protein [Brassica napus] "Phytoene synthase 1, chloroplast precursor (Fruit ripening specific protein pTOM5)" lipase family protein [Arabidopsis thaliana] protein kinase family protein [Arabidopsis thaliana] expressed protein [Arabidopsis thaliana] unknown protein [Arabidopsis thaliana] cytochrome P450-dependent fatty acid hydroxylase [Nicotiana tabacum] "Photosystem II 10 kDa polypeptide, chloroplast precursor (PII10)" "glucuronosyl transferase homolog, ripening-related - tomato (fragment)" cold acclimation protein WCOR413-like protein [Oryza sativa (japonica cultivar-group. 4.2E-57 8E E E E E E E E E-34 3E-102 2E-65

gi| |ref|NP_ | gi| |ref|NP_ | gi|231763|sp|P23418| gi| |ref|NP_ | gi| |gb|AAM | gi| |ref|NP_ | gi| |pir|T08604| gi| |ref|NP_ | gi| |sp|Q40585| gi| |gb|AAL | gi|231687|sp|P30264| gi| |pir|T09390| gi| |ref|NP_ | gi| |gb|AAP | gi| |gb|AAK | gi| |emb|CAC | gi| |sp|Q9AXQ5| gi| |sp|O82528| gi| |ref|NP_ | gi| |pir|T07035| gi| |gb|AAF | gi| |gb|AAK | gi| |gb|AAM | gi| |pir|S68805| gi| |ref|NP_ | gi| |gb|AAP | gi| |ref|NP_ | gi| |gb|AAP | expressed protein [Arabidopsis thaliana] CHALCONE SYNTHASE 1 (NARINGENIN-CHALCONE SYNTHASE 1) cupin family protein [Arabidopsis thaliana] flavanone 3 beta-hydroxylase [Solanum tuberosum] "AMP-binding protein, putative [Arabidopsis thaliana]" hypothetical protein GRR1 - soybean no apical meristem (NAM) family protein (NAC2) [Arabidopsis thaliana] Vacuolar ATP synthase 16 kDa proteolipid subunit NADH-ubiquinone oxidoreductase [Retama raetam] Catalase isozyme 1 21K protein precursor - alfalfa expressed protein [Arabidopsis thaliana] chitinase [Euonymus europaeus] thaumatin-like protein [Capsicum annuum] chitinase [Vitis vinifera] Eukaryotic translation initiation factor 5A-2 (eIF-5A 2) 60S RIBOSOMAL PROTEIN L15 "VHL binding protein, putative / prefoldin, putative [Arabidopsis thaliana]" "histone H1, stress-inducible - tomato" chitinase [Poa pratensis] LD43488p [Drosophila melanogaster] aldehyde-alcohol dehydrogenase E [Mastigamoeba balamuthi] pectin acetylesterase (EC ) precursor - mung bean phagocytosis and cell motility protein ELMO1-related [Arabidopsis thaliana] putative histone H2 protein [Oryza sativa (japonica cultivar-group)] "eukaryotic translation initiation factor SUI1, putative [Arabidopsis thaliana]" phospholipid hydroperoxide glutathione peroxidase [Lycopersicon esculentum] 6.2E E E E E E E E E E E E-23 2E E E E E E E-87 2E E-23 2E E E E-17 gi| |gb|AAG | gi| |ref|NP_ | gi| |pir|H96788| gi| |gb|AAO | gi|542089|pir|JQ2272| gi| |ref|NP_ | gi| |dbj|BAB | gi| |gb|AAO | gi| |ref|NP_ | gi| |sp|O24031| gi| |pir|T07079| gi| |dbj|BAB | gi|119714|sp|P13983| gi| |ref|NP_ | gi| |ref|NP_ | gi| |ref|NP_ | gi| |gb|AAK | gi| |gb|AAO | gi| |ref|NP_ | gi| |gb|AAF | cytosolic aconitase [Nicotiana tabacum] zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] protein T4O12.26 [imported] - Arabidopsis thaliana gamma-aminobutyrate transaminase subunit precursor isozyme 1 [Lycopersicon. "formate dehydrogenase (EC ) precursor, mitochondrial - potato" sec61beta family protein [Arabidopsis thaliana] unnamed protein product [Arabidopsis thaliana] unknown protein [Oryza sativa (japonica cultivar-group)] expressed protein [Arabidopsis thaliana] Probable phospholipid hydroperoxide glutathione peroxidase (PHGPx) leucine-rich repeat protein LRP - tomato putative ADP-ribosylation factor [Oryza sativa (japonica cultivar-group)] Extensin precursor (Cell wall hydroxyproline-rich glycoprotein) "peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase histone H2A [Arabidopsis thaliana] hypothetical protein predicted by GeneMark [Bacillus anthracis A2012] unknown protein [Arabidopsis thaliana] putative polyubiquitin [Arabidopsis thaliana] SNF7 family protein [Arabidopsis thaliana] ubiquitin conjugating protein [Avicennia marina] 2E E E E E-14 4E E E-17 1E E E E E E E E E E-36 I H Accession numberFirst BLAST hitE value ACCNRACCNR 15 DPA B+7