Howard Hughes Medical Institute-NMSU Research Scholar

Slides:



Advertisements
Similar presentations
Single Nucleotide Polymorphism And Association Studies Stat 115 Dec 12, 2006.
Advertisements

PCR Polymerase Chain Reaction Mariam Cortes Tormo Miami Children’s Hospital Research institute 2013.
Module 12 Human DNA Fingerprinting and Population Genetics p 2 + 2pq + q 2 = 1.
DNA Fingerprinting and Forensic Analysis
Polymerase Chain Reaction (PCR) and Its Applications by Ayaz Najafov Boğaziçi University Department of Molecular Biology and Genetics.
Cloning lab results Cloning the human genome Physical map of the chromosomes Genome sequencing Integrating physical and recombination maps Polymorphic.
Biology and Bioinformatics Gabor T. Marth Department of Biology, Boston College BI820 – Seminar in Quantitative and Computational Problems.
Salit Kark Department of Evolution, Systematics and Ecology The Silberman Institute of Life Sciences The Hebrew University of Jerusalem Conservation Biology.
Population Genetics of Puccinia coronata f. sp. avenae Hattie Dambroski and Martin Carson USDA-ARS Cereal Disease Laboratory Saint Paul, MN.
- Delphine MUTHS & Jérôme BOURJEA - Connectivity of Marine Protected Areas in South-Western Indian Ocean: Using population genetics of reef fish to contribute.
PCR Primer Design
Chapter 3 -- Genetics Diversity Importance of Genetic Diversity Importance of Genetic Diversity -- Maintenance of genetic diversity is a major focus of.
DNA Forensics. DNA Fingerprinting - What is It? Use of molecular genetic methods that determine the exact genotype of a DNA sample in a such a way that.
Reading the Blueprint of Life
Advanced Molecular Biological Techniques. Polymerase Chain Reaction animation.
IN THE NAME OF GOD. PCR Primer Design Lecturer: Dr. Farkhondeh Poursina.
Biodiversity IV: genetics and conservation
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
Section 2 -- Genetics Diversity
Single Nucleotide Polymorphisms Mrs. Stewart Medical Interventions Central Magnet School.
Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA.
Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.
Construction of an Enriched Microsatellite Library for the Lizard Sceloporus undulates erythrocheilus Wendy Jin, Matthew Rand, Stefano Zweifel Department.
Module 1 Section 1.3 DNA Technology
Polymerase Chain Reaction (PCR) What is PCR?: Use of DNA polymerase to selectively amplify a segment of DNA from a much larger sample. Xeroxing DNA, start.
Short Tandem Repeats (STR) and Variable Number Tandem Repeats (VNTR)
Molecular identification of living things. Molecular Markers Single locus marker Multi-locus marker RFLP Microsatellite DNA Fingerprinting AFLP RAPD.
Revision – Concept map.
Development and Application of SNP markers in Genome of shrimp (Fenneropenaeus chinensis) Jianyong Zhang Marine Biology.
Used for detection of genetic diseases, forensics, paternity, evolutionary links Based on the characteristics of mammalian DNA Eukaryotic genome 1000x.
Announcements: Proposal resubmission deadline 4/23 (Thursday).
Conservation Genetics of the Plains Topminnow, Fundulus sciadicus The plains topminnow (Fundulus sciadicus) is a freshwater killifish endemic to the Great.
Genetic Diversity Biology/Env S 204 Spring Genetic diversity Heritable variation within and between populations of organisms Encoded in the sequence.
DNA-Based Identifications of Tilapia in Hawaii College of Tropical Agriculture and Human Resources University of Hawaii at Manoa Jinzeng Yang and Harry.
©2001 Timothy G. Standish Romans 5:17 17For if by one man’s offence death reigned by one; much more they which receive abundance of grace and of the gift.
Got Milk? SNPs, Inheritance, and the Evolution of Lactose Tolerance.
François Ancien Sascha Kretzschmann Olivier Suplis Genotyping Errors Causes, Consequences and Solutions Genotyping Errors.
PCR has numerous applications :
BDC331 Conservation Genetics 2015 Mr. Adriaan Engelbrecht Department of Biodiversity and Conservation Biology New Life Sciences Building Core 2, Room
1 DNA Polymorphisms: DNA markers a useful tool in biotechnology Any section of DNA that varies among individuals in a population, “many forms”. Examples.
Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.
Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.
A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #5 Polymerase.
Class 22 DNA Polymorphisms Based on Chapter 10 Recombinant DNA Technology Copyright © 2010 Pearson Education Inc.
Randy W. DeYoung, Erin M. Wehland, Damon L
Johnson - The Living World: 3rd Ed. - All Rights Reserved - McGraw Hill Companies Genomics Chapter 10 Copyright © McGraw-Hill Companies Permission required.
Conservation Genetics
Simple-Sequence Length Polymorphisms SSLPs Short tandemly repeated DNA sequences that are present in variable copy numbers at a given locus. Scattered.
Higher Human Biology Unit 1 Human Cells KEY AREA 5: Human Genomics.
Population Structure High population divergence at the state level Populations from western Indiana genetically differed from the BONWR population Genetic.
Inferences on human demographic history using computational Population Genetic models Gabor T. Marth Department of Biology Boston College Chestnut Hill,
Simple-Sequence Length Polymorphisms
Samuel A. Logan, Prattana Phuekvilai and Kirsten Wolff
GENETIC MARKERS (RFLP, AFLP, RAPD, MICROSATELLITES, MINISATELLITES)
ASSESSMENT OF GENETIC VARIATION IN CACAO CLONES COLLECTION OF
Molecular Marker Characterization of plant genotypes
MOLECULAR MARKERS.
Crystiana Tsujiura (’14) and Judy L. Stone
Spotted bat (Euderma maculatum) microsatellite marker discovery
DNA Marker Lecture 10 BY Ms. Shumaila Azam
Rachel Bautzmann, Mentor: Dr
Genetics and Biometrics
Sequences and their Properties
Microsatellite Mutations and Inferences About Human Demography
Calculating genetic biodiversity
Molecular Biology lecture -Putnoky
DNA Polymorphisms: DNA markers a useful tool in biotechnology
BI820 – Seminar in Quantitative and Computational Problems in Genomics
Restriction Fragment Length Polymorphism (RFLP)
Figure Genetic characterization of the novel GYG1 gene mutation (A) GYG1_cDNA sequence and position of primers used. Genetic characterization of the novel.
Presentation transcript:

Howard Hughes Medical Institute-NMSU Research Scholar Microsatellite Identification in the Thick-billed Parrot (Rhynchopsitta pachyrhyncha) By: Daniel Acosta Howard Hughes Medical Institute-NMSU Research Scholar Dr. Wright’s Lab Department of Biology

Thick-billed Parrot International Union for Conservation of Nature (IUCN 2007) World Parrot Trust Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999) Habitat degradation and fragmentation from logging

Range

Genetic Variation High degree of genetic variation to reduce the impact of founder effect, which may lead to genetic differentiation To adapt to a changing environment and to avoid reduced reproductive fitness. Importance to any translocation.

Microsatellites Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms Found in coding and non-coding regions They have a high mutation rate and high variability in natural populations. High degree of polymorphism All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.

Methods: Isolation of Microsatellites Boil clone in TE buffer Genetic Library DNA Extraction PCR T3/T7 T3/T7/GT10 (Kongrit et. al., 2008) (Zane et. al. 2002)

Methods: Primer Design Sequencing Primer Design CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGA ATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG Test for amplification in thick-billed parrot DNA Optimize Primers Polymorphism

Polymorphism Having genetic diversity Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=(1+3+3+2+2+1) / 6 = 2 These calculations tell us a great deal about the genetic variation of the target population

Progress and Future Goals Up to date: 3 primers we designed and 4 designed for other species. These primers have been optimized for [Mg] and annealing temperature. We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population. Compare wild population to captive population

Acknowledgements Howard Hughes Medical Institute-NMSU Research Program Dr. Timothy Wright Ph. D Student Erin Schirtzinger Ph. D Student Swati Mukherjee Ph. D Student Alejandro Salinas Nadine Lamberski @ San Diego Zoo Kari L. Schmidt. @ American Museum of Natural History

References IUCN 2007. Rhynchopsitta pachyrhyncha. <http://www.iucnredlist.org/search/details.php/19715/all> (March 26, 2 008 2007). Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide microsatellite loci in the Asian elephant (Elephas maximus). Molecular Ecology 8, 175-177 Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto. 1999. Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24 Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite isolation: a review. Molecular Ecology 11, 1-16g

Picture Sources http://www.avianweb.com/images/birds/parrots/thickbilledparrots/thickbilled.jpg (map) http://content.cdlib.org/xtf/data/13030/xw/ft0f59n6xw/figures/ft0f59n6xw_00001.gif http://www.aviary.org/~aviary/images/thick-billed%20parrots.jpg http://www.dkimages.com/discover/previews/928/55058803.JPG http://www.sabo.org/images/tbpanest.jpg http://www.expeditionswest.com/adventures/2004/sierra_madre/JourneyOneSatevo/images/DSCF3627.jpg

Questions??