Sequencing TRAF1 in patients with rheumatoid arthritis Bruce C. Jobse Medical and Population Genetics Broad Institute.

Slides:



Advertisements
Similar presentations
What is an association study? Define linkage disequilibrium
Advertisements

Saliva sample collection with using Oragene®DNA kit DNA extraction & purification Gel electrophoresis Experimental Outline DNA quality and quantity assessment.
Single Nucleotide Polymorphism And Association Studies Stat 115 Dec 12, 2006.
Julia Krushkal 4/11/2017 The International HapMap Project: A Rich Resource of Genetic Information Julia Krushkal Lecture in Bioinformatics 04/15/2010.
SHI Meng. Abstract The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants,
CBG metaprotein composition shown in Figure 2. Associations also found between the IL28B rs genotype and SVR (p = 5.06×10 -5 ) and between CBG.
Genome-wide Association Study Focus on association between SNPs and traits Tendency – Larger and larger sample size – Use of more narrowly defined phenotypes(blood.
High-density admixture mapping to find genes for complex disease David Reich Harvard Medical School Department of Genetics Broad Institute July 13, 2004.
1 of 25 Sequence Variation in Ensembl. 2 of 25 Outline SNPs SNPs in Ensembl Linkage disequilibrium SNPs in BioMart DAS sources.
Fatchiyah, PhD Dept Biology UB Fatchiyah.lecture.ub.ac.id
The role of variation in finding functional genetic elements Andy Clark – Cornell Dave Begun – UC Davis.
Dr. Almut Nebel Dept. of Human Genetics University of the Witwatersrand Johannesburg South Africa Significance of SNPs for human disease.
Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.
Applying haplotype models to association study design Natalie Castellana June 7, 2005.
SNP Resources: Finding SNPs, Databases and Data Extraction Debbie Nickerson
NIEHS SNPs Workshop Introduction Debbie Nickerson Department of Genome Sciences University of Washington.
SNP Resources: Finding SNPs, Databases and Data Extraction Debbie Nickerson NIEHS SNPs Workshop.
SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD Robert J. Livingston, PhD NIEHS Variation Workshop January 30-31, 2005.
Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr.
Something related to genetics? Dr. Lars Eijssen. Bioinformatics to understand studies in genomics – São Paulo – June Image:
SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD SeattleSNPs Variation Workshop March 20-21, 2006.
Genome Variations & GWAS
Design Considerations in Large- Scale Genetic Association Studies Michael Boehnke, Andrew Skol, Laura Scott, Cristen Willer, Gonçalo Abecasis, Anne Jackson,
Supervisor: Yihong Jennifer Tan Eric Gähwiler Karim Hamidi
LARA MANGRAVITE SAGE BIONETWORKS ON BEHALF OF THE RA CHALLENGE ORGANIZING TEAM The DREAM Rheumatoid Arthritis Responder Challenge: Motivation, Data, Scoring.
Butte Lab Journal Club 16 Aug 2010 Alexander A. Morgan.
Understanding miRNA Turnover: A Study of miRNA Half-Life
Luke Alden Yancy, Jr. Mentor: Robert Riley Broad Institute of MIT & Harvard Cambridge, MA.
Computational research for medical discovery at Boston College Biology Gabor T. Marth Boston College Department of Biology
Medical variations Gabor T. Marth Boston College Biology Department BI543 Fall 2013 February 5, 2013.
Doug Brutlag 2011 Genomics & Medicine Doug Brutlag Professor Emeritus of Biochemistry &
Loss-of-co-Homozygosity mapping and exome sequencing of a Syrian pedigree identified the candidate causal mutation associated with rheumatoid arthritis.
A single-nucleotide polymorphism tagging set for human drug metabolism and transport Kourosh R Ahmadi, Mike E Weale, Zhengyu Y Xue, Nicole Soranzo, David.
Detection of Genomic Rearrangements in K562 cells using Paired End Sequencing Rosa Maria Alvarez Massachusetts Institute of Technology Class of 2009.
Conservation of genomic segments (haplotypes): The “HapMap” n In populations, it appears the the linear order of alleles (“haplotype”) is conserved in.
Biology 101 DNA: elegant simplicity A molecule consisting of two strands that wrap around each other to form a “twisted ladder” shape, with the.
Molecular & Genetic Epi 217 Association Studies
SNP Haplotypes as Diagnostic Markers Shrish Tiwari CCMB, Hyderabad.
Genome-Wide Association Study (GWAS)
1 of 32 Sequence Variation in Ensembl. 2 of 32 Outline SNPs SNPs in Ensembl Haplotypes & Linkage Disequilibrium SNPs in BioMart HapMap project Strain-specific.
The 1000 Genomes Project Gil McVean Department of Statistics, Oxford.
Common NOS1AP genetic variation and QT interval duration in African Americans Sara Tribune Tougaloo College Summer Research Program in Genomics.
Melanie Dunn 9/20/2011.  Rheumatoid arthritis (RA) is a chronic disease that leads to inflammation of the joints and surrounding tissues that can also.
Polymorphism Haixu Tang School of Informatics. Genome variations underlie phenotypic differences cause inherited diseases.
Detection of positive selection in humane genome.
Polymorphisms in the CRP and C1 Q genes and schizophrenia in Armenian population: A pilot study Zakharyan R 1,2, Khoyetsyan A 1, Chavushyan A 1, Arakelyan.
FaceBase Kick-Off Meeting Nov 15-16, 2009 Bethesda Oral Clefts: Moving from Genome Wide Studies Toward Functional Genomics TH Beaty for Alan F Scott, Ingo.
The International Consortium. The International HapMap Project.
Single nucleotide polymorphisms and Large scale variation
Replication and Finemapping of Quantitative Trait Loci Influencing QT interval duration in the Jackson Heart Study Sara Tribune Mentor: Christopher Newton-Cheh.
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College
NCSU Summer Institute of Statistical Genetics, Raleigh 2004: Genome Science Session 3: Genomic Variation.
A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.
Canadian Bioinformatics Workshops
Using public resources to understand associations Dr Luke Jostins Wellcome Trust Advanced Courses; Genomic Epidemiology in Africa, 21 st – 26 th June 2015.
成大婦產部學術研討會 黃體素受體基因之多型性與習慣性流產 的關聯性 蘇美慈 醫師 / 郭保麟 教授.
EBF FLJ31951UBLCP1 IL12B B36 Position Genes LD Regions Genotyped Markers Chr5 (q33.3) rs rs Figure 1. Physical map of 360kb around IL12B.
SCANNING OF CANDIDATE GENES FOR THE SUSCEPTIBILITY OF KAWASAKI DISEASE IN THE HLA REGION Lee JK, Kim JJ, Kim S, Choi IH, Kim KJ, Hong SJ, Seo EJ, Yoo HW,
A Fine Mapping Theorem to Refine Results from Association Genetics Studies S.J. Schrodi, V.E. Garcia, C.M. Rowland Celera, Alameda, CA ABSTRACT Justification.
Inferences on human demographic history using computational Population Genetic models Gabor T. Marth Department of Biology Boston College Chestnut Hill,
Date of download: 7/2/2016 Copyright © 2016 American Medical Association. All rights reserved. From: How to Interpret a Genome-wide Association Study JAMA.
Brendan Burke and Kyle Steffen. Important New Tool in Genomic Medicine GWAS is used to estimate disease risk and test SNPs( the most common type of genetic.
SNPs and complex traits: where is the hidden heritability?
Institute of Oncology, Riga, Latvia
LS Carroll, KM Kendall, MC O'Donovan, MJ Owen and NM Williams
Gene Hunting: Design and statistics
Rare, Low-Frequency, and Common Variants in the Protein-Coding Sequence of Biological Candidate Genes from GWASs Contribute to Risk of Rheumatoid Arthritis 
Effect of polymorphisms on transcriptional regulation in mice
Beyond GWAS Erik Fransen.
Andrew T. DeWan, PhD, Elizabeth W
Presentation transcript:

Sequencing TRAF1 in patients with rheumatoid arthritis Bruce C. Jobse Medical and Population Genetics Broad Institute

The Purpose of the Experiment To identify, via sequencing, any novel casual DNA variants capable of explaining increased RA-risk in Humans

What is Rheumatoid Arthritis (RA)? Chronic autoimmune disorder Afflicts 1% of adults worldwide 60% heritable

The TRAF1-C5 Region: Associated to risk of RA rs – odds-ratio increase of 1.30 common allele – found in 30-40% of population two genes of immunological relevance – TRAF1-C5 1,522 CCP+ RA cases, 1,850 controls (NARAC-I, EIRA-I) 997 CCP+ RA cases, 1,777 controls (NARAC-II, EIRA-II)

Experimental Schema Generated sequence data: – Coding exons, 5’ UTR, 3’ UTR – 96 patients with RA using Sanger sequencing (Broad) – Automated SNP calling algorithms Validated sequence data: – Genotyped all novel SNPs in same RA samples Assessed LD structure – genotyped in CEU HapMap samples – Determined r2 with RA-associated SNP (rs )

Results 29 SNPs were identified (4.5 kb of sequence) – MAF >5%n=8all were in dbSNP – MAF <5%n=2114 were novel 19 out of 22 were genotyped by Sequenom in same 96 patients – SNPs that failed genotyping did not pass quality control tests – Currently assessing SNPs to validate whether real or artifact No significant LD with the RA risk variant in HapMap Assess putative functional SNPs – MAF >5%no missense or functional alleles – MAF <5%4 novel missense alleles

Conclusion No DNA variant found that would disrupt transcript- signals or conserved sequence motifs Further examination of 4 discovered missense SNPs – needs further retesting in the population

Acknowledgements SRPG Program: Bruce Birren Shawna Young Lucia Vielma Mentor: Robert Plenge Broad Institute: Eric Lander David Altshuler Metabolics Group: Candace Guiducci Gabe Crawford